Optical And Nonoptical Aids For Reading And Writing In Individuals With Acquired Low Vision.

To evaluate the use of optical and nonoptical aids during reading and writing activities in individuals with acquired low vision. This study was performed using descriptive and cross-sectional surveys. The data collection instrument was created with structured questions that were developed from an exploratory study and a previous test based on interviews, and it evaluated the following variables: personal characteristics, use of optical and nonoptical aids, and activities that required the use of optical and nonoptical aids. The study population included 30 subjects with acquired low vision and visual acuities of 20/200-20/400. Most subjects reported the use of some optical aids (60.0%). Of these 60.0%, the majority (83.3%) cited spectacles as the most widely used optical aid. The majority (63.3%) of subjects also reported the use of nonoptical aids, the most frequent ones being letter magnification (68.4%), followed by bringing the objects closer to the eyes (57.8%). Subjects often used more than one nonoptical aid. The majority of participants reported the use of optical and nonoptical aids during reading activities, highlighting the use of spectacles, magnifying glasses, and letter magnification; however, even after the use of these aids, we found that the subjects often needed to read the text more than once to understand it. During writing activities, all subjects reported the use of optical aids, while most stated that they did not use nonoptical aids for such activities.

Applications Of Visual Evoked Potentials And Fourier-domain Optical Coherence Tomography In Parkinson's Disease: A Controlled Study.

The goal of this cross-sectional observational study was to quantify the pattern-shift visual evoked potentials (VEP) and the thickness as well as the volume of retinal layers using optical coherence tomography (OCT) across a cohort of Parkinson's disease (PD) patients and age-matched controls. Forty-three PD patients and 38 controls were enrolled. All participants underwent a detailed neurological and ophthalmologic evaluation. Idiopathic PD cases were included. Cases with glaucoma or increased intra-ocular pressure were excluded. Patients were assessed by VEP and high-resolution Fourier-domain OCT, which quantified the inner and outer thicknesses of the retinal layers. VEP latencies and the thicknesses of the retinal layers were the main outcome measures. The mean age, with standard deviation (SD), of the PD patients and controls were 63.1 (7.5) and 62.4 (7.2) years, respectively. The patients were predominantly in the initial Hoehn-Yahr (HY) disease stages (34.8% in stage 1 or 1.5, and 55.8 % in stage 2). The VEP latencies and the thicknesses as well as the volumes of the retinal inner and outer layers of the groups were similar. A negative correlation between the retinal thickness and the age was noted in both groups. The thickness of the retinal nerve fibre layer (RNFL) was 102.7 μm in PD patients vs. 104.2 μm in controls. The thicknesses of retinal layers, VEP, and RNFL of PD patients were similar to those of the controls. Despite the use of a representative cohort of PD patients and high-resolution OCT in this study, further studies are required to establish the validity of using OCT and VEP measurements as the anatomic and functional biomarkers for the evaluation of retinal and visual pathways in PD patients.

The Lea Grating Test In Assessing Detection Grating Acuity In Normal Infants Less Than 4 Months Of Age.

To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.

Effects Of Misalignments In The Retinal Nerve Fiber Layer Thickness Measurements With Spectral Domain Optical Coherence Tomography.

Purpose. To investigate misalignments (MAs) on retinal nerve fiber layer thickness (RNFLT) measurements obtained with Cirrus(©) SD-OCT. Methods. This was a retrospective, observational, cross-sectional study. Twenty-seven healthy and 29 glaucomatous eyes of 56 individuals with one normal exam and another showing MA were included. MAs were defined as an improper alignment of vertical vessels in the en face image. MAs were classified in complete MA (CMA) and partial MA (PMA), according to their site: 1 (superior, outside the measurement ring (MR)), 2 (superior, within MR), 3 (inferior, within MR), and 4 (inferior, outside MR). We compared RNFLT measurements of aligned versus misaligned exams in all 4 sectors, in the superior area (sectors 1 + 2), inferior area (sectors 3 + 4), and within the measurement ring (sectors 2 + 3). Results. RNFLT measurements at 12 clock-hour of eyes with MAs in the superior area (sectors 1 + 2) were significantly lower than those obtained in the same eyes without MAs (P = 0.043). No significant difference was found in other areas (sectors 1 + 2 + 3 + 4, sectors 3 + 4, and sectors 2 + 3). Conclusion. SD-OCT scans with superior MAs may present lower superior RNFLT measurements compared to aligned exams.

Determination Of Tetrakis(hydroxymethyl)phosphonium Sulfate In Commercial Formulations And Cooling Water By Capillary Electrophoresis With Contactless Conductivity Detection.

A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.

Human Herpesvirus Infections Of The Central Nervous System: Laboratory Diagnosis Based On Dna Detection By Nested Pcr In Plasma And Cerebrospinal Fluid Samples.

Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.

Detection Of Explosives On The Surface Of Banknotes By Raman Hyperspectral Imaging And Independent Component Analysis.

The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).

Are Human Peripheral Nerves Sensitive To X-ray Imaging?

Diagnostic imaging techniques play an important role in assessing the exact location, cause, and extent of a nerve lesion, thus allowing clinicians to diagnose and manage more effectively a variety of pathological conditions, such as entrapment syndromes, traumatic injuries, and space-occupying lesions. Ultrasound and nuclear magnetic resonance imaging are becoming useful methods for this purpose, but they still lack spatial resolution. In this regard, recent phase contrast x-ray imaging experiments of peripheral nerve allowed the visualization of each nerve fiber surrounded by its myelin sheath as clearly as optical microscopy. In the present study, we attempted to produce high-resolution x-ray phase contrast images of a human sciatic nerve by using synchrotron radiation propagation-based imaging. The images showed high contrast and high spatial resolution, allowing clear identification of each fascicle structure and surrounding connective tissue. The outstanding result is the detection of such structures by phase contrast x-ray tomography of a thick human sciatic nerve section. This may further enable the identification of diverse pathological patterns, such as Wallerian degeneration, hypertrophic neuropathy, inflammatory infiltration, leprosy neuropathy and amyloid deposits. To the best of our knowledge, this is the first successful phase contrast x-ray imaging experiment of a human peripheral nerve sample. Our long-term goal is to develop peripheral nerve imaging methods that could supersede biopsy procedures.

Sensores ópticos com detecção no infravermelho próximo e médio

Optical chemical sensors with detection in the near and mid infrared region are reviewed. Fundamental concepts of infrared spectroscopy and optical chemical sensors are briefly described, before presenting some aspects on optical chemical sensors, such as synthesis of NIR and IR reagents, preparation of new materials as well as application in determinations of species of biological, industrial and environmental importance.

A screening method for detection of hexavalent chromium levels in soils

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.