In Vitro Evaluation Of Sun Protection Factor And Stability Of Commercial Sunscreens Using Mass Spectrometry.

Sunlight exposure causes several types of injury to humans, especially on the skin; among the most common harmful effects due to ultraviolet (UV) exposure are erythema, pigmentation and lesions in DNA, which may lead to cancer. These long-term effects are minimized with the use of sunscreens, a class of cosmetic products that contains UV filters as the main component in the formulation; such molecules can absorb, reflect or diffuse UV rays, and can be used alone or as a combination to broaden the protection on different wavelengths. Currently, worldwide regulatory agencies define which ingredients and what quantities must be used in each country, and enforce companies to conduct tests that confirm the Sun Protection Factor (SPF) and the UVA (Ultraviolet A) factor. Standard SPF determination tests are currently conducted in vivo, using human subjects. In an industrial mindset, apart from economic and ethical reasons, the introduction of an in vitro method emerges as an interesting alternative by reducing risks associated to UV exposure on tests, as well as providing assertive analytical results. The present work aims to describe a novel methodology for SPF determination directly from sunscreen formulations using the previously described cosmetomics platform and mass spectrometry as the analytical methods of choice.

The Geometric Curvature Of The Spine Of Runners During Maximal Incremental Effort Test.

This study sought to analyse the behaviour of the average spinal posture using a novel investigative procedure in a maximal incremental effort test performed on a treadmill. Spine motion was collected via stereo-photogrammetric analysis in thirteen amateur athletes. At each time percentage of the gait cycle, the reconstructed spine points were projected onto the sagittal and frontal planes of the trunk. On each plane, a polynomial was fitted to the data, and the two-dimensional geometric curvature along the longitudinal axis of the trunk was calculated to quantify the geometric shape of the spine. The average posture presented at the gait cycle defined the spine Neutral Curve. This method enabled the lateral deviations, lordosis, and kyphosis of the spine to be quantified noninvasively and in detail. The similarity between each two volunteers was a maximum of 19% on the sagittal plane and 13% on the frontal (p<0.01). The data collected in this study can be considered preliminary evidence that there are subject-specific characteristics in spinal curvatures during running. Changes induced by increases in speed were not sufficient for the Neutral Curve to lose its individual characteristics, instead behaving like a postural signature. The data showed the descriptive capability of a new method to analyse spinal postures during locomotion; however, additional studies, and with larger sample sizes, are necessary for extracting more general information from this novel methodology.

Desquamation Is A Novel Phenomenon For Collective Prostate Epithelial Cell Deletion After Castration.

The mechanism underlying castration-induced prostate regression, which is a classical physiological concept translated into the therapeutic treatment of advanced prostate cancer, involves epithelial cell apoptosis. In searching for events and mechanisms contributing to prostate regression in response to androgen modulation, we have frequently observed the collective deletion of epithelial cells. This work was undertaken to characterize this phenomenon hereafter named desquamation and to verify its presence after 17β-estradiol (E2) administration. Electron microscopy revealed that the desquamating cells had preserved cell-cell junctions and collapsed nuclear contents. The TUNEL reaction was negative for these cells, which were also negative for cleaved caspases-8, -9, -3 and nuclear apoptosis-inducing factor. Detailed analyses revealed that the condensed chromatin was first affected detaching from the nuclear lamina, which was observable after lamin A immunohistochemistry, suggesting the lack of lamin A degradation. A search in animals treated with supraphysiological E2 employed as an alternative anti-androgen treatment revealed no desquamation. The combined treatment (Cas + E2 group) caused changes particular to each treatment, including desquamation. In conclusion, desquamation appeared as a novel phenomenon contributing to collective prostate epithelial cell deletion, distinct from the classical castration-induced apoptosis and particular to the androgen deprivation resulting from surgical castration, and should be considered as part of the mechanisms promoting organ regression.

Mucopolysaccharidosis Type Ii: Identification Of 30 Novel Mutations Among Latin American Patients.

In this study, 103 unrelated South-American patients with mucopolysaccharidosis type II (MPS II) were investigated aiming at the identification of iduronate-2-sulfatase (IDS) disease causing mutations and the possibility of some insights on the genotype-phenotype correlation The strategy used for genotyping involved the identification of the previously reported inversion/disruption of the IDS gene by PCR and screening for other mutations by PCR/SSCP. The exons with altered mobility on SSCP were sequenced, as well as all the exons of patients with no SSCP alteration. By using this strategy, we were able to find the pathogenic mutation in all patients. Alterations such as inversion/disruption and partial/total deletions of the IDS gene were found in 20/103 (19%) patients. Small insertions/deletions/indels (<22 bp) and point mutations were identified in 83/103 (88%) patients, including 30 novel mutations; except for a higher frequency of small duplications in relation to small deletions, the frequencies of major and minor alterations found in our sample are in accordance with those described in the literature.

Adipokines: Novel Players In Resistant Hypertension.

Resistant hypertension (RH) is a multifactorial disease, frequently associated with obesity and characterized by blood pressure above goal (140/90 mm Hg) despite the concurrent use of ≥3 antihypertensive drugs of different classes. The mechanisms of obesity-related hypertension include, among others, aldosterone excess and inflammatory adipokines, which have demonstrated a significant role in the pathogenesis of metabolic syndrome and RH. This review aims to summarize recent studies on the role of the adipokines leptin, resistin, and adiponectin in the pathophysiology of RH and target-organ damage associated with this condition. The deregulation of adipokine levels has been associated with clinical characteristics frequently recognized in RH such as diabetes, hyperactivity of sympathetic and renin-angiotensin-aldosterone systems, and vascular and renal damage. Strategies to regulate adipokines may be promising for the management of RH and some clinical implications must be considered when managing controlled and uncontrolled patients with RH.

Draft Genome Sequence Of Ft9, A Novel Bacillus Cereus Strain Isolated From A Brazilian Thermal Spring.

A Bacillus cereus strain, FT9, isolated from a hot spring in the midwest region of Brazil, had its entire genome sequenced.

Electrochemical Oxidation Of Landfill Leachate In A Flow Reactor: Optimization Using Response Surface Methodology.

Response surface methodology based on Box-Behnken (BBD) design was successfully applied to the optimization in the operating conditions of the electrochemical oxidation of sanitary landfill leachate aimed for making this method feasible for scale up. Landfill leachate was treated in continuous batch-recirculation system, where a dimensional stable anode (DSA(©)) coated with Ti/TiO2 and RuO2 film oxide were used. The effects of three variables, current density (milliampere per square centimeter), time of treatment (minutes), and supporting electrolyte dosage (moles per liter) upon the total organic carbon removal were evaluated. Optimized conditions were obtained for the highest desirability at 244.11 mA/cm(2), 41.78 min, and 0.07 mol/L of NaCl and 242.84 mA/cm(2), 37.07 min, and 0.07 mol/L of Na2SO4. Under the optimal conditions, 54.99 % of chemical oxygen demand (COD) and 71.07 ammonia nitrogen (NH3-N) removal was achieved with NaCl and 45.50 of COD and 62.13 NH3-N with Na2SO4. A new kinetic model predicted obtained from the relation between BBD and the kinetic model was suggested.

Synthesis And Antitumor Activity Of Novel 1-substituted Phenyl 3-(2-oxo-1,3,4-oxadiazol-5-yl) β-carbolines And Their Mannich Bases.

A series of novel 1-(substituted phenyl)-3-(2-oxo-1,3,4-oxadiazol-5-yl) β-carbolines (4a-e) and the corresponding Mannich bases 5-9(a-c) were synthesized and evaluated for their in vitro antitumor activity against seven human cancer cell lines. Compounds of 4a-e series showed a broad spectrum of antitumor activity, with GI50 values lower than 15μM for five cell lines. The derivative 4b, having the N,N-dimethylaminophenyl group at C-1, displayed the highest activity with GI50 in the range of 0.67-3.20μM. A high selectivity and potent activity were observed for some Mannich bases, particularly towards resistant ovarian (NCI-ADR/RES) cell lines (5a, 5b, 6a, 6c and 9b), and ovarian (OVCAR-03) cell lines (5b, 6a, 6c, 9a, 9b and 9c). In addition, the interaction of compound 4b with DNA was investigated by using UV and fluorescence spectroscopic analysis. These studies indicated that 4b interact with ctDNA by intercalation binding.

Post Hoc Analysis Of The Patricia Randomized Trial Of The Efficacy Of Human Papillomavirus Type 16 (hpv-16)/hpv-18 As04-adjuvanted Vaccine Against Incident And Persistent Infection With Nonvaccine Oncogenic Hpv Types Using An Alternative Multiplex Type-specific Pcr Assay For Hpv Dna.

The efficacy of the human papillomavirus type 16 (HPV-16)/HPV-18 AS04-adjuvanted vaccine against cervical infections with HPV in the Papilloma Trial against Cancer in Young Adults (PATRICIA) was evaluated using a combination of the broad-spectrum L1-based SPF10 PCR-DNA enzyme immunoassay (DEIA)/line probe assay (LiPA25) system with type-specific PCRs for HPV-16 and -18. Broad-spectrum PCR assays may underestimate the presence of HPV genotypes present at relatively low concentrations in multiple infections, due to competition between genotypes. Therefore, samples were retrospectively reanalyzed using a testing algorithm incorporating the SPF10 PCR-DEIA/LiPA25 plus a novel E6-based multiplex type-specific PCR and reverse hybridization assay (MPTS12 RHA), which permits detection of a panel of nine oncogenic HPV genotypes (types 16, 18, 31, 33, 35, 45, 52, 58, and 59). For the vaccine against HPV types 16 and 18, there was no major impact on estimates of vaccine efficacy (VE) for incident or 6-month or 12-month persistent infections when the MPTS12 RHA was included in the testing algorithm versus estimates with the protocol-specified algorithm. However, the alternative testing algorithm showed greater sensitivity than the protocol-specified algorithm for detection of some nonvaccine oncogenic HPV types. More cases were gained in the control group than in the vaccine group, leading to higher point estimates of VE for 6-month and 12-month persistent infections for the nonvaccine oncogenic types included in the MPTS12 RHA assay (types 31, 33, 35, 45, 52, 58, and 59). This post hoc analysis indicates that the per-protocol testing algorithm used in PATRICIA underestimated the VE against some nonvaccine oncogenic HPV types and that the choice of the HPV DNA testing methodology is important for the evaluation of VE in clinical trials. (This study has been registered at ClinicalTrials.gov under registration no. NCT00122681.).

Pollination Ecology Of Two Species Of Elleanthus (orchidaceae): Novel Mechanisms And Underlying Adaptations To Hummingbird Pollination.

Relationships among floral biology, floral micromorphology and pollinator behaviour in bird-pollinated orchids are important issues to understand the evolution of the huge flower diversity within Orchidaceae. We aimed to investigate floral mechanisms underlying the interaction with pollinators in two hummingbird-pollinated orchids occurring in the Atlantic forest. We assessed floral biology, nectar traits, nectary and column micromorphologies, breeding systems and pollinators. In both species, nectar is secreted by lip calli through spaces between the medial lamellar surfaces of epidermal cells. Such form of floral nectar secretion has not been previously described. Both species present functional protandry and are self-compatible yet pollinator-dependent. Fruit sets in hand-pollination experiments were more than twice those under natural conditions, evidencing pollen limitation. The absence of fruit set in interspecific crosses suggests the existence of post-pollination barriers between these synchronopatric species. In Elleanthus brasiliensis, fruits resulting from cross-pollination and natural conditions were heavier than those resulting from self-pollination, suggesting advantages to cross-pollination. Hummingbirds pollinated both species, which share at least one pollinator species. Species differences in floral morphologies led to distinct pollination mechanisms. In E. brasiliensis, attachment of pollinaria to the hummingbird bill occurs through a lever apparatus formed by an appendage in the column, another novelty to the knowledge of orchids. In E. crinipes, pollinaria attachment occurs by simple contact with the bill during insertion into the flower tube, which fits tightly around the bill. The novelties described here illustrate the overlooked richness in ecology and morphophysiology in Orchidaceae. This article is protected by copyright. All rights reserved.

Two Novel Mutations In The Thyroid Hormone Receptor β In Patients With Resistance To Thyroid Hormone (rth β): Clinical, Biochemical, And Molecular Data.

The syndrome of resistance to thyroid hormone (RTH β) is an inherited disorder characterized by variable tissue hyposensitivity to 3,5,30-l-triiodothyronine (T3), with persistent elevation of free-circulating T3 (FT3) and free thyroxine (FT4) levels in association with nonsuppressed serum thyrotropin (TSH). Clinical presentation is variable and the molecular analysis of THRB gene provides a short cut diagnosis. Here, we describe 2 cases in which RTH β was suspected on the basis of laboratory findings. The diagnosis was confirmed by direct THRB sequencing that revealed 2 novel mutations: the heterozygous p.Ala317Ser in subject 1 and the heterozygous p.Arg438Pro in subject 2. Both mutations were shown to be deleterious by SIFT, PolyPhen, and Align GV-GD predictive methods.

Didanosine-loaded Chitosan Microspheres Optimized By Surface-response Methodology: A Modified Maximum Likelihood Classification" Approach Formulation For Reverse Transcriptase Inhibitors."

Didanosine-loaded chitosan microspheres were developed applying a surface-response methodology and using a modified Maximum Likelihood Classification. The operational conditions were optimized with the aim of maintaining the active form of didanosine (ddI), which is sensitive to acid pH, and to develop a modified and mucoadhesive formulation. The loading of the drug within the chitosan microspheres was carried out by ionotropic gelation technique with sodium tripolyphosphate (TPP) as cross-linking agent and magnesium hydroxide (Mg(OH)2) to assure the stability of ddI. The optimization conditions were set using a surface-response methodology and applying the Maximum Likelihood Classification, where the initial chitosan concentration, TPP and ddI concentration were set as the independent variables. The maximum ddI-loaded in microspheres (i.e. 1433mg of ddI/g chitosan), was obtained with 2% (w/v) chitosan and 10% TPP. The microspheres depicted an average diameter of 11.42μm and ddI was gradually released during 2h in simulated enteric fluid.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Novel DMRT1 3'UTR+11insT mutation associated to XY partial gonadal dysgenesis

The Y-chromosome-located SRY gene encodes a small testis-specific protein containing a DNA-binding motif known as the HMG (high mobility group) box. However, mutations in SRY are not frequent especially in cases of 46,XY partial gonadal dysgenesis. Several sex-determining genes direct the fate of the bipotential gonad to either testis or ovary. In addition, heterozygous small deletions in 9p can cause complete and partial XY gonadal dysgenesis without other symptoms. Human DMRT1 gene, which is located at 9p24.3, is expressed in testis and ovary and has been considered, among others, a candidate autosomal gene responsible for gonadal dysgenesis. In this report we describe a nucleotide insertion in DMRT1 3'UTR in a patient of XY partial gonadal dygenesis. The 3'UTR+11insT is located within a conserved motif important for mRNA stabilization.

46,XX DSD and Antley-Bixler syndrome due to novel mutations in the cytochrome P450 oxidoreductase gene

Deficiency of the enzyme P450 oxidoreductase is a rare form of congenital adrenal hyperplasia with characteristics of combined and partial impairments in steroidogenic enzyme activities, as P450 oxidoreductase transfers electrons to CYP21A2, CYP17A1, and CYP19A1. It results in disorders of sex development and skeletal malformations similar to Antley-Bixley syndrome. We report the case of a 9-year-old girl who was born with virilized genitalia (Prader stage V), absence of palpable gonads, 46,XX karyotype, and hypergonadotropic hypogonadism. During the first year of life, ovarian cyst, partial adrenal insufficiency, and osteoarticular changes, such as mild craniosynostosis, carpal and tarsal synostosis, and limited forearm pronosupination were observed. Her mother presented severe virilization during pregnancy. The molecular analysis of P450 oxidoreductase gene revealed compound heterozygosis for the nonsense p.Arg223*, and the novel missense p.Met408Lys, inherited from the father and the mother, respectively. Arq Bras Endocrinol Metab. 2012;56(8):578-85