13 resultados para Nova doença
em Repositório da Produção Científica e Intelectual da Unicamp
Resumo:
BACKGROUND: Total rectocolectomy and ileal pouch-anal anastomosis is the choice surgical procedure for patients with ulcerative colitis. In cases of Crohn's disease post-operative diagnosis, it can be followed by pouch failure. AIM: To evaluate ileal pouch-anal anastomosis long-term outcome in patients with Crohn's disease. METHODS: Between February 1983 and March 2007, 151 patients were submitted to ileal pouch-anal anastomosis by Campinas State University Colorectal Unit, Campinas, SP, Brazil, 76 had pre-operative ulcerative colitis diagnosis and 11 had post-operative Crohn's disease diagnosis. Crohn's disease diagnosis was made by histopathological biopsies in nine cases, being one in surgical specimen, two cases in rectal stump, small bowel in two cases, ileal pouch in three and in perianal abscess in one of them. The median age was 30.6 years and eight (72.7%) were female. RESULTS: All patients had previous ulcerative colitis diagnosis and in five cases emergency colectomy was done by toxic megacolon. The mean time until of Crohn's disease diagnosis was 30.6 (6-80) months after ileal pouch-anal anastomosis. Ileostomy closure was possible in 10 cases except in one that had ileal pouch fistula, perianal disease and small bowel involvement. In the long-term follow-up, three patients had perineal fistulas and one had also a pouch-vaginal fistula. All of them were submitted to a new ileostomy and one had the pouch excised. Another patient presented pouch-vaginal fistula which was successfully treated by mucosal flap. Three patients had small bowel involvement and three others, pouch involvement. All improved with medical treatment. Presently, the mean follow-up is 76.5 months and all patients are in clinical remission, and four have fecal diversion. The remaining patients have good functional results with 6-10 bowel movements/day. CONCLUSION: Crohn's disease diagnosis after ileal pouch-anal anastomosis for ulcerative colitis may be usual and later complications such fistulas and stenosis are common. However, when left in situ ileal pouch is associated with good function.
Resumo:
BACKGROUND: Strictureplasty is an alternative surgical procedure for Crohn?s disease, particulary in patients with previous resections or many intestinal stenosis. AIM: To analyze surgical complications and clinical follow-up in patients submitted to strictureplasty secondary to Crohn?s disease. METHODS: Twenty-eight patients (57.1% male, mean age 33.3 years, range 16-54 years) with Crohn?s disease and intestinal stenosis (small bowel, ileocecal region and ileocolic anastomosis) were submitted to strictureplasty, at one institution, between September 1991 and May 2004. Thirteen patients had previous intestinal resections. The mean follow-up was 58.1 months. A total of 116 strictureplasties were done (94 Heineke-Mikulicz - 81%, 15 Finney - 13%, seven side-to-side ileocolic strictureplasty - 6%). Three patients were submitted to strictureplasty at two different surgical procedures and two in three procedures. RESULTS: Regarding to strictureplasty, postoperative complication rate was 25% and mortality was 3.6%. Early local complication rate was 57.1%, with three suture leaks (10.7%) and late complication was present in two patients, both with incisional hernial and enterocutaneous fistulas (28.6%). Patients remained hospitalized during a medium time of 12.4 days. Clinical and surgical recurrence rates were 63% and 41%, respectively. Among the patients submitted to another surgery, two patients had two more operations and one had three. Recurrence rate at strictureplasty site was observed in 3.5%, being Finney technique the commonest one. Presently, 19 patients had been asymptomatic with the majority of them under medical therapy. CONCLUSION: Strictureplasties have low complication rates, in spite of having been done at compromised site, with long term pain relief. Considering the clinical course of Crohn?s disease, with many patients being submitted to intestinal resections, strictureplasties should be considered as an effective surgical treatment to spare long intestinal resections.
Resumo:
Moyamoya is a chronic progressive cerebrovascular disease with characteristic angiographic findings and a clinical picture with episodes of transient ischemic attacks, headache, seizures, hemiparesis, which may resolve after surgical treatment. We describe the case of a girl with the typical findings of the disease, comparing them before and after surgery with the use of neuropsychological tests, neurological examination and laboratory tests.
Resumo:
OBJECTIVE: To verify the effectiveness of the support group in the identification of family variables linked to epilepsy. METHOD: Pre-test were applied to parents of 21 children with benign epilepsy of childhood recently diagnosed, from 5 to 15 years, who participated in the groups at HC/Unicamp. There was a presentation of an educational video, discussion and application of the post-test 1. After six months, the post-test 2 was applied. RESULTS: The beliefs were: fear of swallowing the tongue during the seizures (76.19%) and of a future mental disease (66.67%). Facing the epilepsy, fear and sadness appeared. 76.19% of the parents presented overprotection and 90.48%, expected a new seizure. In the post-test 1, the parents affirmed that the information offered had modified the beliefs. In the post-test 2, 80.95% didn't report great doubts about epilepsy and 90.48% considered their relationship with their children better. CONCLUSIONS: The demystification of beliefs supplied from the groups influenced the family positively, prevented behavior alterations and guaranteed effective care in the attendance to the child with epilepsy.
Resumo:
Quimica Nova and the Journal of the Brazilian Chemical Society are two examples of successful initiatives taken by the Brazilian Chemical Society (SBQ - Sociedade Brasileira de Química), and may serve as models for the scientific societies of developing countries. Pillars of the SBQ, these two periodicals are undeniable demonstrations that idealism, utopia and dignity are the essential ingredients for transforming dreams into reality. Few believed that the Brazilian chemical community would one day have, as it does today, two scientific research periodicals indexed in the principal international data banks.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
A new species of Mimosa (Leguminosae, Mimosoideae, Mimosae) from Mato Grosso do Sul state, Midwestern Brazil, M. ferricola R.R. Silva & A.M.G. Azevedo, is described and illustrated. Morphologically M. ferricola is related to M. gemmulata Barneby and to M. nothopteris Barneby, and belongs to Mimosa sect. Batocaulon DC. ser. Leiocarpae Benth.
Resumo:
357
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas. Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas. Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas. Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física