Prevalence Of Treponema Spp. In Endodontic Retreatment-resistant Periapical Lesions.

This study investigated the presence of the Treponema species in longstanding endodontic retreatment-resistant lesions of teeth with apical periodontitis, the association of this species with clinical/radiographic features, and the association among the different target species. Microbial samples of apical lesions were collected from twenty-five adult patients referred to endodontic surgery after unsuccessful root canal retreatment. Nested-PCR and conventional PCR were used for Treponema detection. Twenty-three periradicular tissue samples showed detectable levels of bacterial DNA. Treponema species were detected in 28% (7/25) of the cases. The most frequently detected species were T. socranskii (6/25), followed by T. maltophilum (3/25), T. amylovorum (3/25), T. lecithinolyticum (3/25), T. denticola (3/25), T. pectinovorum (2/25) and T. medium (2/25). T. vicentii was not detected in any sample. Positive statistical association was found between T. socranskii and T. denticola, and between T. maltophilum and T. lecithinolyticum . No association was detected between the presence of any target microorganism and the clinical or radiographic features. Treponema spp. are present, in a low percentage, in longstanding apical lesions from teeth with endodontic retreatment failure.

Photocatalytic Degradation Of Ofloxacin And Evaluation Of The Residual Antimicrobial Activity.

Ofloxacin is an antimicrobial agent frequently found in significant concentrations in wastewater and surface water. Its continuous introduction into the environment is a potential risk to non-target organisms or to human health. In this study, ofloxacin degradation by UV/TiO2 and UV/TiO2/H2O2, antimicrobial activity (E. coli) of samples subjected to these processes, and by-products formed were evaluated. For UV/TiO2, the degradation efficiency was 89.3% in 60 min of reaction when 128 mg L(-1) TiO2 were used. The addition of 1.68 mmol L(-1) hydrogen peroxide increased degradation to 97.8%. For UV/TiO2, increasing the catalyst concentration from 4 to 128 mg L(-1) led to an increase in degradation efficiency. For both processes, the antimicrobial activity was considerably reduced throughout the reaction time. The structures of two by-products are presented: m/z 291 (9-fluoro-3-methyl-10-(methyleneamino)-7-oxo-2,3-dihydro-7H-[1,4]oxazino[2,3,4-ij]quinoline-6-carboxylic acid) and m/z 157 ((Z)-2-formyl-3-((2-oxoethyl)imino)propanoic acid).

Malpighiaceae: correlations between habit, fruit type and basic chromosome number

The family Malpighiaceae presents species with different habits, fruit types and cytological characters. Climbers are considered the most derived habit, followed, respectively, by the shrubby and arboreal ones. The present study examines the relationship between basic chromosome numbers and the derivation of climbing habit and fruit types in Malpighiaceae. A comparison of all the chromosome number reports for Malpighiaceae showed a predominance of chromosome numbers based on x=5 or 10 in the genera of sub-family Malpighioideae, mainly represented by climbers with winged fruits, whereas non-climbing species with non-winged fruits, which predominate in sub-family Byrsonimoideae, had counts based on x=6, which is considered the less derived basic number for the family. Based on such data, confirmed by statistic assays, and on the monophyletic origin of this family, we admit the hypothesis that morphological derivation of habit and fruit is correlated with chromosome basic number variation in the family Malpighiaceae.

Germinação de Ternstroemia brasiliensis Cambess. (Pentaphylacaceae) de floresta de restinga

The main purpose of this work was to study the germination of Ternstroemia brasiliensis seeds both in laboratory and field conditions in order to contribute to understanding the regeneration ecology of the species. The seeds were dispersed with relatively high moisture content and exhibit a recalcitrant storage behaviour because of their sensitivity to dehydration and to dry storage. The germinability is relatively high and is not affected either by light or aril presence. The absence of the dormancy and the low sensitivity to far red light can enable to seeds to promptly germinate under Restinga forest canopy, not forming a soil seed bank. The constant temperatures of 25 ºC and 30 ºC were considered optimum for germination of T. brasiliensis seeds. Temperature germination parameters can be affected by light conditions. The thermal-time model can be a suitable tool for investigating the temperature dependence on the seed germination of T. brasiliensis. The germination characteristics de T. brasiliensis are typical of non pioneer species, and help to explain the distribution of the species. Germination of T. brasiliensis seeds in Restinga environment may be not limited by light and temperature; otherwise the soil moisture content can affect the seed germination.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Egfr Activating Mutations And Their Association With Response To Platinum-doublet Chemotherapy In Brazilian Non-small Cell Lung Cancer Patients.

The aim of the study was to analyze the frequency of epidermal growth factor receptor (EGFR) mutations in Brazilian non-small cell lung cancer patients and to correlate these mutations with response to benefit of platinum-based chemotherapy in non-small cell lung cancer (NSCLC). Our cohort consisted of prospective patients with NSCLCs who received chemotherapy (platinum derivates plus paclitaxel) at the [UNICAMP], Brazil. EGFR exons 18-21 were analyzed in tumor-derived DNA. Fifty patients were included in the study (25 with adenocarcinoma). EGFR mutations were identified in 6/50 (12 %) NSCLCs and in 6/25 (24 %) adenocarcinomas; representing the frequency of EGFR mutations in a mostly self-reported White (82.0 %) southeastern Brazilian population of NSCLCs. Patients with NSCLCs harboring EGFR exon 19 deletions or the exon 21 L858R mutation were found to have a higher chance of response to platinum-paclitaxel (OR 9.67 [95 % CI 1.03-90.41], p = 0.047). We report the frequency of EGFR activating mutations in a typical southeastern Brazilian population with NSCLC, which are similar to that of other countries with Western European ethnicity. EGFR mutations seem to be predictive of a response to platinum-paclitaxel, and additional studies are needed to confirm or refute this relationship.

Oxidative Stress And Susceptibility To Mitochondrial Permeability Transition Precedes The Onset Of Diabetes In Autoimmune Non-obese Diabetic Mice.

Beta cell destruction in type 1 diabetes (TID) is associated with cellular oxidative stress and mitochondrial pathway of cell death. The aim of this study was to determine whether oxidative stress and mitochondrial dysfunction are present in T1D model (non-obese diabetic mouse, NOD) and if they are related to the stages of disease development. NOD mice were studied at three stages: non-diabetic, pre-diabetic, and diabetic and compared with age-matched Balb/c mice. Mitochondria respiration rates measured at phosphorylating and resting states in liver and soleus biopsies and in isolated liver mitochondria were similar in NOD and Balb/c mice at the three disease stages. However, NOD liver mitochondria were more susceptible to calcium-induced mitochondrial permeability transition as determined by cyclosporine-A-sensitive swelling and by decreased calcium retention capacity in all three stages of diabetes development. Mitochondria H2O2 production rate was higher in non-diabetic, but unaltered in pre-diabetic and diabetic NOD mice. The global cell reactive oxygen species (ROS), but not specific mitochondria ROS production, was significantly increased in NOD lymphomononuclear and stem cells in all disease stages. In addition, marked elevated rates of 2',7'-dichlorodihydrofluorescein (H2DCF) oxidation were observed in pancreatic islets from non-diabetic NOD mice. Using matrix-assisted laser desorption/ionization (MALDI) mass spectrometry (MS) and lipidomic approach, we identified oxidized lipid markers in NOD liver mitochondria for each disease stage, most of them being derivatives of diacylglycerols and phospholipids. These results suggest that the cellular oxidative stress precedes the establishment of diabetes and may be the cause of mitochondrial dysfunction that is involved in beta cell death.

The Putative Leishmania Telomerase Rna (leishter) Undergoes Trans-splicing And Contains A Conserved Template Sequence.

Telomerase RNAs (TERs) are highly divergent between species, varying in size and sequence composition. Here, we identify a candidate for the telomerase RNA component of Leishmania genus, which includes species that cause leishmaniasis, a neglected tropical disease. Merging a thorough computational screening combined with RNA-seq evidence, we mapped a non-coding RNA gene localized in a syntenic locus on chromosome 25 of five Leishmania species that shares partial synteny with both Trypanosoma brucei TER locus and a putative TER candidate-containing locus of Crithidia fasciculata. Using target-driven molecular biology approaches, we detected a ∼2,100 nt transcript (LeishTER) that contains a 5' spliced leader (SL) cap, a putative 3' polyA tail and a predicted C/D box snoRNA domain. LeishTER is expressed at similar levels in the logarithmic and stationary growth phases of promastigote forms. A 5'SL capped LeishTER co-immunoprecipitated and co-localized with the telomerase protein component (TERT) in a cell cycle-dependent manner. Prediction of its secondary structure strongly suggests the existence of a bona fide single-stranded template sequence and a conserved C[U/C]GUCA motif-containing helix II, representing the template boundary element. This study paves the way for further investigations on the biogenesis of parasite TERT ribonucleoproteins (RNPs) and its role in parasite telomere biology.

Water Stress Reveals Differential Antioxidant Responses Of Tolerant And Non-tolerant Sugarcane Genotypes.

The biochemical responses of the enzymatic antioxidant system of a drought-tolerant cultivar (IACSP 94-2094) and a commercial cultivar in Brazil (IACSP 95-5000) grown under two levels of soil water restriction (70% and 30% Soil Available Water Content) were investigated. IACSP 94-2094 exhibited one additional active superoxide dismutase (Cu/Zn-SOD VI) isoenzyme in comparison to IACSP 95-5000, possibly contributing to the heightened response of IACSP 94-2094 to the induced stress. The total glutathione reductase (GR) activity increased substantially in IACSP 94-2094 under conditions of severe water stress; however, the appearance of a new GR isoenzyme and the disappearance of another isoenzyme were found not to be related to the stress response because the cultivars from both treatment groups (control and water restrictions) exhibited identical changes. Catalase (CAT) activity seems to have a more direct role in H2O2 detoxification under water stress condition and the shift in isoenzymes in the tolerant cultivar might have contributed to this response, which may be dependent upon the location where the excessive H2O2 is being produced under stress. The improved performance of IACSP 94-2094 under drought stress was associated with a more efficient antioxidant system response, particularly under conditions of mild stress.

Trichomes Related To An Unusual Method Of Water Retention And Protection Of The Stem Apex In An Arid Zone Perennial Species.

It is well known that trichomes protect plant organs, and several studies have investigated their role in the adaptation of plants to harsh environments. Recent studies have shown that the production of hydrophilic substances by glandular trichomes and the deposition of this secretion on young organs may facilitate water retention, thus preventing desiccation and favouring organ growth until the plant develops other protective mechanisms. Lychnophora diamantinana is a species endemic to the Brazilian 'campos rupestres' (rocky fields), a region characterized by intense solar radiation and water deficits. This study sought to investigate trichomes and the origin of the substances observed on the stem apices of L. diamantinana. Samples of stem apices, young and expanded leaves were studied using standard techniques, including light microscopy and scanning and transmission electron microscopy. Histochemical tests were used to identify the major groups of metabolites present in the trichomes and the hyaline material deposited on the apices. Non-glandular trichomes and glandular trichomes were observed. The material deposited on the stem apices was hyaline, highly hydrophilic and viscous. This hyaline material primarily consists of carbohydrates that result from the partial degradation of the cell wall of uniseriate trichomes. This degradation occurs at the same time that glandular trichomes secrete terpenoids, phenolic compounds and proteins. These results suggest that the non-glandular trichomes on the leaves of L. diamantinana help protect the young organ, particularly against desiccation, by deposition of highly hydrated substances on the apices. Furthermore, the secretion of glandular trichomes probably repels herbivore and pathogen attacks.