10 resultados para Non-specific stress indicators

em Repositório da Produção Científica e Intelectual da Unicamp


Relevância:

100.00% 100.00%

Publicador:

Resumo:

Biofilm formation on reverse osmosis (RO) systems represents a drawback in the application of this technology by different industries, including oil refineries. In RO systems the feed water maybe a source of microbial contamination and thus contributes for the formation of biofilm and consequent biofouling. In this study the planktonic culturable bacterial community was characterized from a feed water of a RO system and their capacities were evaluated to form biofilm in vitro. Bacterial motility and biofilm control were also analysed using phages. As results, diverse Protobacteria, Actinobacteria and Bacteroidetes were identified. Alphaproteobacteria was the predominant group and Brevundimonas, Pseudomonas and Mycobacterium the most abundant genera. Among the 30 isolates, 11 showed at least one type of motility and 11 were classified as good biofilm formers. Additionally, the influence of non-specific bacteriophage in the bacterial biofilms formed in vitro was investigated by action of phages enzymes or phage infection. The vB_AspP-UFV1 (Podoviridae) interfered in biofilm formation of most tested bacteria and may represent a good alternative in biofilm control. These findings provide important information about the bacterial community from the feed water of a RO system that may be used for the development of strategies for biofilm prevention and control in such systems.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Three cases of probable neurobrucellosis are reported. The diagnosis was made on the basis of imunological tests. Two patients with a clinical picture of meningomyelitis showed a definitive clinical improvement under tetraciclin and streptomòcin therapy. The imunological reactions found in the record case were even more positive in the spinal fluid than in the blood. In the case 3 with a clinical presentation of cerebral hemorrage the hitopathological studies demonstrated non specific chronic leptomeningitis and local hemorrages in the caudate nucleus bilaterally. The diagnose and treatment of neurobrucellosis are discussed, stressing the importance of an early therapy.

Relevância:

50.00% 50.00%

Publicador:

Resumo:

Beta cell destruction in type 1 diabetes (TID) is associated with cellular oxidative stress and mitochondrial pathway of cell death. The aim of this study was to determine whether oxidative stress and mitochondrial dysfunction are present in T1D model (non-obese diabetic mouse, NOD) and if they are related to the stages of disease development. NOD mice were studied at three stages: non-diabetic, pre-diabetic, and diabetic and compared with age-matched Balb/c mice. Mitochondria respiration rates measured at phosphorylating and resting states in liver and soleus biopsies and in isolated liver mitochondria were similar in NOD and Balb/c mice at the three disease stages. However, NOD liver mitochondria were more susceptible to calcium-induced mitochondrial permeability transition as determined by cyclosporine-A-sensitive swelling and by decreased calcium retention capacity in all three stages of diabetes development. Mitochondria H2O2 production rate was higher in non-diabetic, but unaltered in pre-diabetic and diabetic NOD mice. The global cell reactive oxygen species (ROS), but not specific mitochondria ROS production, was significantly increased in NOD lymphomononuclear and stem cells in all disease stages. In addition, marked elevated rates of 2',7'-dichlorodihydrofluorescein (H2DCF) oxidation were observed in pancreatic islets from non-diabetic NOD mice. Using matrix-assisted laser desorption/ionization (MALDI) mass spectrometry (MS) and lipidomic approach, we identified oxidized lipid markers in NOD liver mitochondria for each disease stage, most of them being derivatives of diacylglycerols and phospholipids. These results suggest that the cellular oxidative stress precedes the establishment of diabetes and may be the cause of mitochondrial dysfunction that is involved in beta cell death.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The biochemical responses of the enzymatic antioxidant system of a drought-tolerant cultivar (IACSP 94-2094) and a commercial cultivar in Brazil (IACSP 95-5000) grown under two levels of soil water restriction (70% and 30% Soil Available Water Content) were investigated. IACSP 94-2094 exhibited one additional active superoxide dismutase (Cu/Zn-SOD VI) isoenzyme in comparison to IACSP 95-5000, possibly contributing to the heightened response of IACSP 94-2094 to the induced stress. The total glutathione reductase (GR) activity increased substantially in IACSP 94-2094 under conditions of severe water stress; however, the appearance of a new GR isoenzyme and the disappearance of another isoenzyme were found not to be related to the stress response because the cultivars from both treatment groups (control and water restrictions) exhibited identical changes. Catalase (CAT) activity seems to have a more direct role in H2O2 detoxification under water stress condition and the shift in isoenzymes in the tolerant cultivar might have contributed to this response, which may be dependent upon the location where the excessive H2O2 is being produced under stress. The improved performance of IACSP 94-2094 under drought stress was associated with a more efficient antioxidant system response, particularly under conditions of mild stress.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The metabolic enzyme fatty acid synthase (FASN) is responsible for the endogenous synthesis of palmitate, a saturated long-chain fatty acid. In contrast to most normal tissues, a variety of human cancers overexpress FASN. One such cancer is cutaneous melanoma, in which the level of FASN expression is associated with tumor invasion and poor prognosis. We previously reported that two FASN inhibitors, cerulenin and orlistat, induce apoptosis in B16-F10 mouse melanoma cells via the intrinsic apoptosis pathway. Here, we investigated the effects of these inhibitors on non-tumorigenic melan-a cells. Cerulenin and orlistat treatments were found to induce apoptosis and decrease cell proliferation, in addition to inducing the release of mitochondrial cytochrome c and activating caspases-9 and -3. Transfection with FASN siRNA did not result in apoptosis. Mass spectrometry analysis demonstrated that treatment with the FASN inhibitors did not alter either the mitochondrial free fatty acid content or composition. This result suggests that cerulenin- and orlistat-induced apoptosis events are independent of FASN inhibition. Analysis of the energy-linked functions of melan-a mitochondria demonstrated the inhibition of respiration, followed by a significant decrease in mitochondrial membrane potential (ΔΨm) and the stimulation of superoxide anion generation. The inhibition of NADH-linked substrate oxidation was approximately 40% and 61% for cerulenin and orlistat treatments, respectively, and the inhibition of succinate oxidation was approximately 46% and 52%, respectively. In contrast, no significant inhibition occurred when respiration was supported by the complex IV substrate N,N,N',N'-tetramethyl-p-phenylenediamine (TMPD). The protection conferred by the free radical scavenger N-acetyl-cysteine indicates that the FASN inhibitors induced apoptosis through an oxidative stress-associated mechanism. In combination, the present results demonstrate that cerulenin and orlistat induce apoptosis in non-tumorigenic cells via mitochondrial dysfunction, independent of FASN inhibition.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

This article seeks to investigate associations between satisfaction with life and sociodemographic variables, health conditions, functionality, social involvement and social support among elderly caregivers and non-caregivers, as well as between satisfaction and the intensity of stress in the caregiver group. A sample of 338 caregivers was selected according to two items of the Brazilian version of the Elders Life Stress Inventory. A comparison-group of elderly non-caregivers was selected at random, with a similar gender, age and income profile. Data were derived from self-reported questionnaires and scales. Elderly caregivers with low levels of satisfaction and high levels of stress revealed more symptoms of insomnia, fatigue, diseases and worse IADL performance. Those with greater satisfaction and less stress revealed a good level of social support. Insomnia, depression and fatigue were associated with low satisfaction among caregivers, and with fatigue, depression and low social support among non-caregivers. It was considered relevant that instrumental, psychological and informative support can improve the quality of life and the quality of care provided by elderly caregivers, especially if they are affected by unfavorable health and psychosocial conditions and low satisfaction with life.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Herein, we provide new contribution to the mechanisms involved in keratinocytes response to hyperosmotic shock showing, for the first time, the participation of Low Molecular Weight Protein Tyrosine Phosphatase (LMWPTP) activity in this event. We reported that sorbitol-induced osmotic stress mediates alterations in the phosphorylation of pivotal cytoskeletal proteins, particularly Src and cofilin. Furthermore, an increase in the expression of the phosphorylated form of LMWPTP, which was followed by an augment in its catalytic activity, was observed. Of particular importance, these responses occurred in an intracellular milieu characterized by elevated levels of reduced glutathione (GSH) and increased expression of the antioxidant enzymes glutathione peroxidase and glutathione reductase. Altogether, our results suggest that hyperosmostic stress provides a favorable cellular environment to the activation of LMWPTP, which is associated with increased expression of antioxidant enzymes, high levels of GSH and inhibition of Src kinase. Finally, the real contribution of LMWPTP in the hyperosmotic stress response of keratinocytes was demonstrated through analysis of the effects of ACP1 gene knockdown in stressed and non-stressed cells. LMWPTP knockdown attenuates the effects of sorbitol induced-stress in HaCaT cells, mainly in the status of Src kinase, Rac and STAT5 phosphorylation and activity. These results describe for the first time the participation of LMWPTP in the dynamics of cytoskeleton rearrangement during exposure of human keratinocytes to hyperosmotic shock, which may contribute to cell death.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física