4 resultados para Mosca-dos-fungos
em Repositório da Produção Científica e Intelectual da Unicamp
Resumo:
This work aimed at determining the occurrence of heat resistant molds during the aseptic processing of tomato pulp (8° BRIX). During tomato harvest, 9 lots were sampled (3 at the beginning, 3 at the apex and 3 at the end of harvest) and other 5 lots were sampled between harvest. For each lot, the enumeration of heat resistant molds was carried out in samples collected during the aseptic process. The mean count of heat resistant molds was relatively low, ranging from <1 to 8CFU/100mL of sample. The higher counts were observed in the raw material and the pre-wash and transportation water. Fifty strains of heat resistant molds detected in the enumeration procedure were isolated, codified and stocked. One-month-old spores of each isolate were submitted to different heat shocks to select the most heat resistant mold. The most heat resistant isolated strain (survived 100° C/25 minutes) was identified as Neosartorya fischeri.
Resumo:
One of the main objectives of applying edible coatings on fruits surface is to create a protective film to reduce weight loss due to evaporation and transpiration and also to decrease the risk of fruit rot caused by environmental contamination, in order to improve the visual aspect. Therefore, it is possible to increase shelf life, and decrease post harvest losses. Persimmon is a much appreciated fruit, with high potential for export, but sensitive to handling and storage. This study aimed to evaluate the effect of applying the edible coating Megh Wax ECF-124 (18% of active composts, consisting of emulsion of carnauba wax, anionic surfactant, preservative and water) produced by Megh Industry and Commerce Ltda in three different concentrations (25, 50 and 100%) on post harvest quality of 'Fuyu' persimmon stored for 14 days. The attributes evaluated for quality were: firmness, pH, acidity, soluble solids, weight loss and color. The results showed that application of carnauba wax in different concentrations was effective on decreasing weight loss of persimmon cv. Fuyu and maintenance of color aspects. Treatment at lower concentration, 25%, showed lower rate of discharge, but high concentrations showed lower values of mass loss. Carnauba wax application showed a high potential for use on postharvest conservation, and can be applied together with other technologies, helping to maintain quality for export.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
A case of brain abscess and meningitis due to pigmented fungi is reported. The patient was a 59-year-old white male, who had enjoyed excellent health until October 1977, when he developed headache, later accompanied by paresthesias and weakness in the left-sided extremities. These symptoms worsened progressively and in November of that year he had to quit his job. From February 1978 on he became inactive and anorexic. Intense continuous headache was associated with frequent episodes of vomiting. He gradually became tor-porous, and according to his relatives, suffered from visual and possibly auditory deficiency. On examination, he was malnourished and dehydrated, with decubitus ulcers. Temperature was 38,5°C. A left-sided spastic hemiplegia and prominent meningorradicular signs were noted. The CSF was examined six times between May 17th and June 1st and showed variable hypercytosis (143 to 4,437 leucocytes/ cu mm) with predominance of neutrophils (up tp 95%), low glucose and high protein concentrations. No microorganisms were identified. Electroencephalographic study disclosed a low background activity especially in left temporal areas. Despite supportive care and antibiotic therapy he lapsed into coma. Carotid angiography was normal on June 1st. He remained in deep coma until his death on June 6th, 1978. Necropsy was limited to the brain, which weighed 1,550 g after fixation and showed diffuse intense edema and hyperemia. On coronal sectioning an encapsulated abscess was found in the right basal ganglia, which also involved the internal capsule, and measured 1.5 cm in diameter. Microscopical examination disclosed large numbers of brownish fungi, appearing both as oval yeasts and as septate hyphae in the thick fibrous capsule and in the necrotic content of the abscess. The same organisms were demonstrated in moderate numbers in the leptomeninges of the medulla oblongata and , less frequently, of the hippo-campal region and cerebellum.