27 resultados para Molecular detection

em Repositório da Produção Científica e Intelectual da Unicamp


Relevância:

30.00% 30.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Guarana seeds have the highest caffeine concentration among plants accumulating purine alkaloids, but in contrast with coffee and tea, practically nothing is known about caffeine metabolism in this Amazonian plant. In this study, the levels of purine alkaloids in tissues of five guarana cultivars were determined. Theobromine was the main alkaloid that accumulated in leaves, stems, inflorescences and pericarps of fruit, while caffeine accumulated in the seeds and reached levels from 3.3% to 5.8%. In all tissues analysed, the alkaloid concentration, whether theobromine or caffeine, was higher in young/immature tissues, then decreasing with plant development/maturation. Caffeine synthase activity was highest in seeds of immature fruit. A nucleotide sequence (PcCS) was assembled with sequences retrieved from the EST database REALGENE using sequences of caffeine synthase from coffee and tea, whose expression was also highest in seeds from immature fruit. The PcCS has 1083bp and the protein sequence has greater similarity and identity with the caffeine synthase from cocoa (BTS1) and tea (TCS1). A recombinant PcCS allowed functional characterization of the enzyme as a bifunctional CS, able to catalyse the methylation of 7-methylxanthine to theobromine (3,7-dimethylxanthine), and theobromine to caffeine (1,3,7-trimethylxanthine), respectively. Among several substrates tested, PcCS showed higher affinity for theobromine, differing from all other caffeine synthases described so far, which have higher affinity for paraxanthine. When compared to previous knowledge on the protein structure of coffee caffeine synthase, the unique substrate affinity of PcCS is probably explained by the amino acid residues found in the active site of the predicted protein.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The introduction of spraying procedures to fabricate layer-by-layer (LbL) films has brought new possibilities for the control of molecular architectures and for making the LbL technique compliant with industrial processes. In this study we show that significantly distinct architectures are produced for dipping and spray-LbL films of the same components, which included DODAB/DPPG vesicles. The films differed notably in their thickness and stratified nature. The electrical response of the two types of films to aqueous solutions containing erythrosin was also different. With multidimensional projections we showed that the impedance for the DODAB/DPPG spray-LbL film is more sensitive to changes in concentration, being therefore more promising as sensing units. Furthermore, with surface-enhanced Raman scattering (SERS) we could ascribe the high sensitivity of the LbL films to adsorption of erythrosin.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The epididymis has an important role in the maturation of sperm for fertilization, but little is known about the epididymal molecules involved in sperm modifications during this process. We have previously described the expression pattern for an antigen in epididymal epithelial cells that reacts with the monoclonal antibody (mAb) TRA 54. Immunohistochemical and immunoblotting analyses suggest that the epitope of the epididymal antigen probably involves a sugar moiety that is released into the epididymal lumen in an androgen-dependent manner and subsequently binds to luminal sperm. Using column chromatography, SDS-PAGE with in situ digestion and mass spectrometry, we have identified the protein recognized by mAb TRA 54 in mouse epididymal epithelial cells. The ∼65 kDa protein is part of a high molecular mass complex (∼260 kDa) that is also present in the sperm acrosomal vesicle and is completely released after the acrosomal reaction. The amino acid sequence of the protein corresponded to that of albumin. Immunoprecipitates with anti-albumin antibody contained the antigen recognized by mAb TRA 54, indicating that the epididymal molecule recognized by mAb TRA 54 is albumin. RT-PCR detected albumin mRNA in the epididymis and fertilization assays in vitro showed that the glycoprotein complex containing albumin was involved in the ability of sperm to recognize and penetrate the egg zona pellucida. Together, these results indicate that epididymal-derived albumin participates in the formation of a high molecular mass glycoprotein complex that has an important role in egg fertilization.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The taxonomic status of a disjunctive population of Phyllomedusa from southern Brazil was diagnosed using molecular, chromosomal, and morphological approaches, which resulted in the recognition of a new species of the P. hypochondrialis group. Here, we describe P. rustica sp. n. from the Atlantic Forest biome, found in natural highland grassland formations on a plateau in the south of Brazil. Phylogenetic inferences placed P. rustica sp. n. in a subclade that includes P. rhodei + all the highland species of the clade. Chromosomal morphology is conservative, supporting the inference of homologies among the karyotypes of the species of this genus. Phyllomedusa rustica is apparently restricted to its type-locality, and we discuss the potential impact on the strategies applied to the conservation of the natural grassland formations found within the Brazilian Atlantic Forest biome in southern Brazil. We suggest that conservation strategies should be modified to guarantee the preservation of this species.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Although several treatments for tendon lesions have been proposed, successful tendon repair remains a great challenge for orthopedics, especially considering the high incidence of re-rupture of injured tendons. Our aim was to evaluate the pharmacological potential of Aloe vera on the content and arrangement of glycosaminoglycans (GAGs) during tendon healing, which was based on the effectiveness of A. vera on collagen organization previously observed by our group. In rats, a partial calcaneal tendon transection was performed with subsequent topical A. vera application at the injury site. The tendons were treated with A. vera ointment for 7 days and excised on the 7(th) , 14(th) , or 21(st) day post-surgery. Control rats received ointment without A. vera. A higher content of GAGs and a lower amount of dermatan sulfate were detected in the A. vera-treated group on the 14(th) day compared with the control. Also at 14 days post-surgery, a lower dichroic ratio in toluidine blue stained sections was observed in A. vera-treated tendons compared with the control. No differences were observed in the chondroitin-6-sulfate and TGF-β1 levels between the groups, and higher amount of non-collagenous proteins was detected in the A. vera-treated group on the 21(st) day, compared with the control group. No differences were observed in the number of fibroblasts, inflammatory cells and blood vessels between the groups. The application of A. vera during tendon healing modified the arrangement of GAGs and increased the content of GAGs and non-collagenous proteins.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Despite the ecological and economic importance of passion fruit (Passiflora spp.), molecular markers have only recently been utilized in genetic studies of this genus. In addition, both basic genetic researches related to population studies and pre-breeding programs of passion fruit remain scarce for most Passiflora species. Considering the number of Passiflora species and the increasing use of these species as a resource for ornamental, medicinal, and food purposes, the aims of this review are the following: (i) to present the current condition of the passion fruit crop; (ii) to quantify the applications and effects of using molecular markers in studies of Passiflora; (iii) to present the contributions of genetic engineering for passion fruit culture; and (iv) to discuss the progress and perspectives of this research. Thus, the present review aims to summarize and discuss the relationship between historical and current progress on the culture, breeding, and molecular genetics of passion fruit.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Wormlike micelles formed by the addition to cetyltrimethylammonium bromide (CTAB) of a range of aromatic cosolutes with small molecular variations in their structure were systematically studied. Phenol and derivatives of benzoate and cinnamate were used, and the resulting mixtures were studied by oscillatory, steady-shear rheology, and the microstructure was probed by small-angle neutron scattering. The lengthening of the micelles and their entanglement result in remarkable viscoelastic properties, making rheology a useful tool to assess the effect of structural variations of the cosolutes on wormlike micelle formation. For a fixed concentration of CTAB and cosolute (200 mmol L(-1)), the relaxation time decreases in the following order: phenol > cinnamate> o-hydroxycinnamate > salicylate > o-methoxycinnamate > benzoate > o-methoxybenzoate. The variations in viscoelastic response are rationalized by using Mulliken population analysis to map out the electronic density of the cosolutes and quantify the barrier to rotation of specific groups on the aromatics. We find that the ability of the group attached to the aromatic ring to rotate is crucial in determining the packing of the cosolute at the micellar interface and thus critically impacts the micellar growth and, in turn, the rheological response. These results enable us for the first time to propose design rules for the self-assembly of the surfactants and cosolutes resulting in the formation of wormlike micelles with the cationic surfactant CTAB.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Isatin, an indole alkaloid has been shown to have anti-microbial, anti-tumor and anti-inflammatory effects. Due to its findings, we evaluated whether this alkaloid would have any effect on TNBS-induced colitis. Animals (male Unib:WH rats, aged 8 weeks old) were induced colitis through a rectal administration of 2,4,6-trinitrobenzene sulphonic acid using a catheter inserted 8 cm into the rectum of the animals. The rats were divided into two major groups: non-colitic and colitic. The colitic group was sub-divided into 6 groups (10 animals per group): colitic non-treated, Isatin 3; 6; 12.5; 18.75 and 25 mg/kg. Our main results showed that the oral treatment with Isatin 6 and 25 mg/kg were capable of avoiding the increase in TNF-α, COX-2 and PGE₂ levels when compared to the colitic non-treated group. Interestingly, the same doses (6 and 25 mg/kg) were also capable of preventing the decrease in IL-10 levels comparing with the colitic non-treated group. The levels of MPO, (an indirect indicator of neutrophil presence), were also maintained lower than those of the colitic non-treated group. Isatin also prevented the decrease of SOD activity and increase of GSH-Px and GSH-Rd activity as well as the depletion of GSH levels. In conclusion, both pre-treatments (6 and 25 mg/kg) were capable of protecting the gut mucosa against the injury caused by TNBS, through the combination of antioxidant and anti-inflammatory properties, which, together, showed a protective activity of the indole alkaloid Isatin.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The phytopathogenic fungus Moniliophthora perniciosa (Stahel) Aime & Philips-Mora, causal agent of witches' broom disease of cocoa, causes countless damage to cocoa production in Brazil. Molecular studies have attempted to identify genes that play important roles in fungal survival and virulence. In this study, sequences deposited in the M. perniciosa Genome Sequencing Project database were analyzed to identify potential biological targets. For the first time, the ergosterol biosynthetic pathway in M. perniciosa was studied and the lanosterol 14α-demethylase gene (ERG11) that encodes the main enzyme of this pathway and is a target for fungicides was cloned, characterized molecularly and its phylogeny analyzed. ERG11 genomic DNA and cDNA were characterized and sequence analysis of the ERG11 protein identified highly conserved domains typical of this enzyme, such as SRS1, SRS4, EXXR and the heme-binding region (HBR). Comparison of the protein sequences and phylogenetic analysis revealed that the M. perniciosa enzyme was most closely related to that of Coprinopsis cinerea.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Passiflora species are distributed throughout Latin America, and Brazil and Colombia serve as the centers of diversity for this genus. We performed cross-species amplification to evaluate 109 microsatellite loci in 14 Passiflora species and estimated the diversity and genetic structure of Passiflora cincinnata, Passiflora setaceae and Passiflora edulis. A total of 127 accessions, including 85 accessions of P. edulis, a commercial species, and 42 accessions of 13 wild species, were examined. The cross-species amplification was effective for obtaining microsatellite loci (average cross-amplification of 70%). The average number of alleles per locus (five) was relatively low, and the average diversity ranged from 0.52 in P. cincinnata to 0.32 in P. setacea. The Bayesian analyses indicated that the P. cincinnata and P. setacea accessions were distributed into two groups, and the P. edulis accessions were distributed into five groups. Private alleles were identified, and suggestions for core collections are presented. Further collections are necessary, and the information generated may be useful for breeding and conservation.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Solid lipid nanoparticles (SLNs) have been proposed in the 1990s as appropriate drug delivery systems, and ever since they have been applied in a wide variety of cosmetic and pharmaceutical applications. In addition, SLNs are considered suitable alternatives as carriers in gene delivery. Although important advances have been made in this particular field, fundamental knowledge of the underlying mechanisms of SLN-mediated gene delivery is conspicuously lacking, an imperative requirement in efforts aimed at further improving their efficiency. Here, we address recent advances in the use of SLNs as platform for delivery of nucleic acids as therapeutic agents. In addition, we will discuss available technology for conveniently producing SLNs. In particular, we will focus on underlying molecular mechanisms by which SLNs and nucleic acids assemble into complexes and how the nucleic acid cargo may be released intracellularly. In discussing underlying mechanisms, we will, when appropriate, refer to analogous studies carried out with systems based on cationic lipids and polymers, that have proven useful in the assessment of structure-function relationships. Finally, we will give suggestions for improving SLN-based gene delivery systems, by pointing to alternative methods for SLNplex assembly, focusing on the realization of a sustained nucleic acid release.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.