Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Microbial Evaluation Of Traumatized Teeth Treated With Triple Antibiotic Paste Or Calcium Hydroxide With 2% Chlorhexidine Gel In Pulp Revascularization.

Revascularization outcome depends on microbial elimination because apical repair will not happen in the presence of infected tissues. This study evaluated the microbial composition of traumatized immature teeth and assessed their reduction during different stages of the revascularization procedures performed with 2 intracanal medicaments. Fifteen patients (7-17 years old) with immature teeth were submitted to the revascularization procedures; they were divided into 2 groups according to the intracanal medicament used: TAP group (n = 7), medicated with a triple antibiotic paste, and CHP group (n = 8), dressed with calcium hydroxide + 2% chlorhexidine gel. Samples were taken before any treatment (S1), after irrigation with 6% NaOCl (S2), after irrigation with 2% chlorhexidine (S3), after intracanal dressing (S4), and after 17% EDTA irrigation (S5). Cultivable bacteria recovered from the 5 stages were counted and identified by means of polymerase chain reaction assay (16S rRNA). Both groups had colony-forming unit counts significantly reduced after S2 (P < .05); however, no significant difference was found between the irrigants (S2 and S3, P = .99). No difference in bacteria counts was found between the intracanal medicaments used (P = .95). The most prevalent bacteria detected were Actinomyces naeslundii (66.67%), followed by Porphyromonas endodontalis, Parvimonas micra, and Fusobacterium nucleatum, which were detected in 33.34% of the root canals. An average of 2.13 species per canal was found, and no statistical correlation was observed between bacterial species and clinical/radiographic features. The microbial profile of infected immature teeth is similar to that of primarily infected permanent teeth. The greatest bacterial reduction was promoted by the irrigation solutions. The revascularization protocols that used the tested intracanal medicaments were efficient in reducing viable bacteria in necrotic immature teeth.

Phylogenetic Analysis Of The Microbial Community In Hypersaline Petroleum Produced Water From The Campos Basin.

In this work the archaea and eubacteria community of a hypersaline produced water from the Campos Basin that had been transported and discharged to an onshore storage facility was evaluated by 16S recombinant RNA (rRNA) gene sequence analysis. The produced water had a hypersaline salt content of 10 (w/v), had a carbon oxygen demand (COD) of 4,300 mg/l and contains phenol and other aromatic compounds. The high salt and COD content and the presence of toxic phenolic compounds present a problem for conventional discharge to open seawater. In previous studies, we demonstrated that the COD and phenolic content could be largely removed under aerobic conditions, without dilution, by either addition of phenol degrading Haloarchaea or the addition of nutrients alone. In this study our goal was to characterize the microbial community to gain further insight into the persistence of reservoir community members in the produced water and the potential for bioremediation of COD and toxic contaminants. Members of the archaea community were consistent with previously identified communities from mesothermic reservoirs. All identified archaea were located within the phylum Euryarchaeota, with 98 % being identified as methanogens while 2 % could not be affiliated with any known genus. Of the identified archaea, 37 % were identified as members of the strictly carbon-dioxide-reducing genus Methanoplanus and 59 % as members of the acetoclastic genus Methanosaeta. No Haloarchaea were detected, consistent with the need to add these organisms for COD and aromatic removal. Marinobacter and Halomonas dominated the eubacterial community. The presence of these genera is consistent with the ability to stimulate COD and aromatic removal with nutrient addition. In addition, anaerobic members of the phyla Thermotogae, Firmicutes, and unclassified eubacteria were identified and may represent reservoir organisms associated with the conversion hydrocarbons to methane.

Microbial Lipid Production: Screening With Yeasts Grown On Brazilian Molasses.

Rhodotorula glutinis CCT 2182, Rhodosporidium toruloides CCT 0783, Rhodotorula minuta CCT 1751 and Lipomyces starkeyi DSM 70296 were evaluated for the conversion of sugars from Brazilian molasses into single-cell oil (SCO) feedstock for biodiesel. Pulsed fed-batch fermentations were performed in 1.65 l working volume bioreactors. The maximum specific growth rate (µmax), lipid productivity (Pr) and cellular lipid content were, respectively, 0.23 h(-1), 0.41 g l(-1) h(-1), and 41% for Rsp. toruloides; 0.20 h(-1), 0.27 g l(-1) h(-1), and 36% for Rta. glutinis; 0.115 h(-1), 0.135 g l(-1) h(-1), and 27 % for Rta. minuta; and 0.11 h(-1), 0.13 g l(-1) h(-1), and 32% for L. starkeyi. Based on their microbial lipid productivity, content, and profile, Rsp. toruloides and Rta. glutinis are promising candidates for biodiesel production from Brazilian molasses. All the oils from the yeasts were similar to the composition of plant oils (rapeseed and soybean) and could be used as raw material for biofuels, as well as in food and nutraceutical products.

Comparative Metagenomic Analysis Of Coral Microbial Communities Using A Reference-independent Approach.

By comparing the SEED and Pfam functional profiles of metagenomes of two Brazilian coral species with 29 datasets that are publicly available, we were able to identify some functions, such as protein secretion systems, that are overrepresented in the metagenomes of corals and may play a role in the establishment and maintenance of bacteria-coral associations. However, only a small percentage of the reads of these metagenomes could be annotated by these reference databases, which may lead to a strong bias in the comparative studies. For this reason, we have searched for identical sequences (99% of nucleotide identity) among these metagenomes in order to perform a reference-independent comparative analysis, and we were able to identify groups of microbial communities that may be under similar selective pressures. The identification of sequences shared among the metagenomes was found to be even better for the identification of groups of communities with similar niche requirements than the traditional analysis of functional profiles. This approach is not only helpful for the investigation of similarities between microbial communities with high proportion of unknown reads, but also enables an indirect overview of gene exchange between communities.

The Lea Grating Test In Assessing Detection Grating Acuity In Normal Infants Less Than 4 Months Of Age.

To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.

Determination Of Tetrakis(hydroxymethyl)phosphonium Sulfate In Commercial Formulations And Cooling Water By Capillary Electrophoresis With Contactless Conductivity Detection.

A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.

Human Herpesvirus Infections Of The Central Nervous System: Laboratory Diagnosis Based On Dna Detection By Nested Pcr In Plasma And Cerebrospinal Fluid Samples.

Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.

Prevalence Of Treponema Spp. In Endodontic Retreatment-resistant Periapical Lesions.

This study investigated the presence of the Treponema species in longstanding endodontic retreatment-resistant lesions of teeth with apical periodontitis, the association of this species with clinical/radiographic features, and the association among the different target species. Microbial samples of apical lesions were collected from twenty-five adult patients referred to endodontic surgery after unsuccessful root canal retreatment. Nested-PCR and conventional PCR were used for Treponema detection. Twenty-three periradicular tissue samples showed detectable levels of bacterial DNA. Treponema species were detected in 28% (7/25) of the cases. The most frequently detected species were T. socranskii (6/25), followed by T. maltophilum (3/25), T. amylovorum (3/25), T. lecithinolyticum (3/25), T. denticola (3/25), T. pectinovorum (2/25) and T. medium (2/25). T. vicentii was not detected in any sample. Positive statistical association was found between T. socranskii and T. denticola, and between T. maltophilum and T. lecithinolyticum . No association was detected between the presence of any target microorganism and the clinical or radiographic features. Treponema spp. are present, in a low percentage, in longstanding apical lesions from teeth with endodontic retreatment failure.

Detection Of Explosives On The Surface Of Banknotes By Raman Hyperspectral Imaging And Independent Component Analysis.

The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).

New Fefe-hydrogenase Genes Identified In A Metagenomic Fosmid Library From A Municipal Wastewater Treatment Plant As Revealed By High-throughput Sequencing.

A fosmid metagenomic library was constructed with total community DNA obtained from a municipal wastewater treatment plant (MWWTP), with the aim of identifying new FeFe-hydrogenase genes encoding the enzymes most important for hydrogen metabolism. The dataset generated by pyrosequencing of a fosmid library was mined to identify environmental gene tags (EGTs) assigned to FeFe-hydrogenase. The majority of EGTs representing FeFe-hydrogenase genes were affiliated with the class Clostridia, suggesting that this group is the main hydrogen producer in the MWWTP analyzed. Based on assembled sequences, three FeFe-hydrogenase genes were predicted based on detection of the L2 motif (MPCxxKxxE) in the encoded gene product, confirming true FeFe-hydrogenase sequences. These sequences were used to design specific primers to detect fosmids encoding FeFe-hydrogenase genes predicted from the dataset. Three identified fosmids were completely sequenced. The cloned genomic fragments within these fosmids are closely related to members of the Spirochaetaceae, Bacteroidales and Firmicutes, and their FeFe-hydrogenase sequences are characterized by the structure type M3, which is common to clostridial enzymes. FeFe-hydrogenase sequences found in this study represent hitherto undetected sequences, indicating the high genetic diversity regarding these enzymes in MWWTP. Results suggest that MWWTP have to be considered as reservoirs for new FeFe-hydrogenase genes.

A screening method for detection of hexavalent chromium levels in soils

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.