An Efficient Protocol For The Generation Of Monocyte Derived Dendritic Cells Using Serum-free Media For Clinical Applications In Post Remission Aml Patients.

Protocols for the generation of dendritic cells (DCs) using serum as a supplementation of culture media leads to reactions due to animal proteins and disease transmissions. Several types of serum-free media (SFM), based on good manufacture practices (GMP), have recently been used and seem to be a viable option. The aim of this study was to evaluate the results of the differentiation, maturation, and function of DCs from Acute Myeloid Leukemia patients (AML), generated in SFM and medium supplemented with autologous serum (AS). DCs were analyzed by phenotype characteristics, viability, and functionality. The results showed the possibility of generating viable DCs in all the conditions tested. In patients, the X-VIVO 15 medium was more efficient than the other media tested in the generation of DCs producing IL-12p70 (p=0.05). Moreover, the presence of AS led to a significant increase of IL-10 by DCs as compared with CellGro (p=0.05) and X-Vivo15 (p=0.05) media, both in patients and donors. We concluded that SFM was efficient in the production of DCs for immunotherapy in AML patients. However, the use of AS appears to interfere with the functional capacity of the generated DCs.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Comparative analysis of adverse events between infliximab and adalimumab in Crohn's disease management: a Brazilian single-centre experience

INTRODUCTION: Data is scarce regarding adverse events (AE) of biological therapy used in the management of Crohn's Disease (CD) among Brazilian patients. OBJECTIVES: To analyse AE prevalence and profile in patients with CD treated with Infliximab (IFX) or Adalimumab (ADA) and to verify whether there are differences between the two drugs. METHOD: Retrospective observational single-centre study of CD patients on biological therapy. Variables analysed: Demographic data, Montreal classification, biological agent administered, treatment duration, presence and type of AE and the need for treatment interruption. RESULTS: Forty-nine patients were analysed, 25 treated with ADA and 24 with IFX. The groups were homogeneous in relation to the variables studied. The average follow-up period for the group treated with ADA was 19.3 months and 21.8 months for the IFX group (p = 0.585). Overall, 40% (n = 10) of patients taking ADA had AE compared with 50% (n = 12) of IFX users (p = 0.571). There was a tendency towards higher incidence of cutaneous and infusion reactions in the IFX group and higher incidence of infections in the ADA treated group, although without significant difference. CONCLUSIONS: No difference was found in the AE prevalence and profile between ADA and IFX CD patients in the population studied.

Homo-motor, ciborgues e... aha! pessoas : da revolução industrial a revolução da informação

Universidade Estadual de Campinas . Faculdade de Educação Física

Crescimento fisico e desempenho motor em crianças de 6 a 12 anos decondição socio-economica media da area urbana da provincia de Arequipa-Peru

Universidade Estadual de Campinas. Faculdade de Educação Física