4 resultados para Mean Intensity of the Claim Process
em Repositório da Produção Científica e Intelectual da Unicamp
Resumo:
Systemic lupus erythematosus is an autoimmune disease that causes many psychological repercussions that have been studied through qualitative research. These are considered relevant, since they reveal the amplitude experienced by patients. Given this importance, this study aims to map the qualitative production in this theme, derived from studies of experiences of adult patients of both genders and that had used as a tool a semi-structured interview and/or field observations, and had made use of a sampling by a saturation criterion to determine the number of participants in each study. The survey was conducted in Pubmed, Lilacs, Psycinfo e Cochrane databases, searching productions in English and Portuguese idioms published between January 2005 and June 2012. The 19 revised papers that have dealt with patients in the acute phase of the disease showed themes that were categorized into eight topics that contemplated the experienced process at various stages, from the onset of the disease, extending through the knowledge of the diagnosis and the understanding of the manifestations of the disease, drug treatment and general care, evolution and prognosis. The collected papers also point to the difficulty of understanding, of the patients, on what consists the remission phase, revealing also that this is a clinical stage underexplored by psychological studies.
Resumo:
CONTEXT: Intestinal constipation - a common symptom among the general population - is more frequent in women. It may be secondary to an improper diet or organic or functional disturbances, such as dyskinesia of the pelvic floor. This is basically characterized by the absence of relaxation or paradoxical contraction of the pelvic floor and anal sphincter during evacuation. OBJECTIVE: To analyze, by manometric data, the anal pressure variation at rest, during evacuation effort by using the Valsalva maneuver and forced post-expiratory apnea in subjects with secondary constipation. METHODS: Twenty-one patients (19 females - 90.4%) with a mean age of 47.5 years old (23-72) were studied. The diagnosis was performed using anorectal manometry, with a catheter containing eight channels disposed at the axial axis, measuring the proximal (1) and distal (2) portions of the anal orifice. The elevation of the pressure values in relation to the resting with the evacuation effort was present in all patients. The Agachan score was used for clinical evaluation of constipation. The variables studied were: mean anal pressure of the anal orifice for 20 seconds at rest, the effort of evacuation using Valsalva maneuver and the effort of evacuation during apnea after forced expiration, as well as the area under the curve of the manometric tracing at moments Valsalva and apnea. RESULTS: The analysis of the mean values of the anal pressure variation at rest evidenced difference between proximal and distal channels (P = 0.007), independent of the moment and tendency to differ during moments Valsalva and apnea (P = 0.06). The mean of values of the area under the manometric tracing curve showed differences between moments Valsalva and apnea (P = 0.0008), either at the proximal portion or at the distal portion of the anal orifice. CONCLUSION: The effort of evacuation associated with postexpiratory apnea, when compared with the effort associated with the Valsalva maneuver, provides lower elevation of anal pressure at rest by the parameter area under the curve.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física