8 resultados para Magnetic charge and topology of dyon field
em Repositório da Produção Científica e Intelectual da Unicamp
Resumo:
The aim of this study is to test the feasibility and reproducibility of diffusion-weighted magnetic resonance imaging (DW-MRI) evaluations of the fetal brains in cases of twin-twin transfusion syndrome (TTTS). From May 2011 to June 2012, 24 patients with severe TTTS underwent MRI scans for evaluation of the fetal brains. Datasets were analyzed offline on axial DW images and apparent diffusion coefficient (ADC) maps by two radiologists. The subjective evaluation was described as the absence or presence of water diffusion restriction. The objective evaluation was performed by the placement of 20-mm(2) circular regions of interest on the DW image and ADC maps. Subjective interobserver agreement was assessed by the kappa correlation coefficient. Objective intraobserver and interobserver agreements were assessed by proportionate Bland-Altman tests. Seventy-four DW-MRI scans were performed. Sixty of them (81.1%) were considered to be of good quality. Agreement between the radiologists was 100% for the absence or presence of diffusion restriction of water. For both intraobserver and interobserver agreement of ADC measurements, proportionate Bland-Altman tests showed average percentage differences of less than 1.5% and 95% CI of less than 18% for all sites evaluated. Our data demonstrate that DW-MRI evaluation of the fetal brain in TTTS is feasible and reproducible.
Resumo:
Yellowing is an undesirable phenomenon that is common in people with white and grey hair. Because white hair has no melanin, the pigment responsible for hair colour, the effects of photodegradation are more visible in this type of hair. The origin of yellowing and its relation to photodegradation processes are not properly established, and many questions remain open in this field. In this work, the photodegradation of grey hair was investigated as a function of the wavelength of incident radiation, and its ultrastructure was determined, always comparing the results obtained for the white and black fibres present in grey hair with the results of white wool. The results presented herein indicate that the photobehaviour of grey hair irradiated with a mercury lamp or with solar radiation is dependent on the wavelength range of the incident radiation and on the initial shade of yellow in the sample. Two types of grey hair were used: (1) blended grey hair (more yellow) and (2) grey hair from a single-donor (less yellow). After exposure to a full-spectrum mercury lamp for 200 h, the blended white hair turned less yellow (the yellow-blue difference, Db(*) becomes negative, Db(*)=-6), whereas the white hair from the single-donor turned slightly yellower (Db(*)=2). In contrast, VIS+IR irradiation resulted in bleaching in both types of hair, whereas a thermal treatment (at 81 °C) caused yellowing of both types of hair, resulting in a Db(*)=3 for blended white hair and Db(*)=9 for single-donor hair. The identity of the yellow chromophores was investigated by UV-Vis spectroscopy. The results obtained with this technique were contradictory, however, and it was not possible to obtain a simple correlation between the sample shade of yellow and the absorption spectra. In addition, the results are discussed in terms of the morphology differences between the pigmented and non-pigmented parts of grey hair, the yellowing and bleaching effects of grey hair, and the occurrence of dark-follow reactions.
Resumo:
High-throughput screening of physical, genetic and chemical-genetic interactions brings important perspectives in the Systems Biology field, as the analysis of these interactions provides new insights into protein/gene function, cellular metabolic variations and the validation of therapeutic targets and drug design. However, such analysis depends on a pipeline connecting different tools that can automatically integrate data from diverse sources and result in a more comprehensive dataset that can be properly interpreted. We describe here the Integrated Interactome System (IIS), an integrative platform with a web-based interface for the annotation, analysis and visualization of the interaction profiles of proteins/genes, metabolites and drugs of interest. IIS works in four connected modules: (i) Submission module, which receives raw data derived from Sanger sequencing (e.g. two-hybrid system); (ii) Search module, which enables the user to search for the processed reads to be assembled into contigs/singlets, or for lists of proteins/genes, metabolites and drugs of interest, and add them to the project; (iii) Annotation module, which assigns annotations from several databases for the contigs/singlets or lists of proteins/genes, generating tables with automatic annotation that can be manually curated; and (iv) Interactome module, which maps the contigs/singlets or the uploaded lists to entries in our integrated database, building networks that gather novel identified interactions, protein and metabolite expression/concentration levels, subcellular localization and computed topological metrics, GO biological processes and KEGG pathways enrichment. This module generates a XGMML file that can be imported into Cytoscape or be visualized directly on the web. We have developed IIS by the integration of diverse databases following the need of appropriate tools for a systematic analysis of physical, genetic and chemical-genetic interactions. IIS was validated with yeast two-hybrid, proteomics and metabolomics datasets, but it is also extendable to other datasets. IIS is freely available online at: http://www.lge.ibi.unicamp.br/lnbio/IIS/.
Resumo:
The purpose of this study was to correlate the pre-operative imaging, vascularity of the proximal pole, and histology of the proximal pole bone of established scaphoid fracture non-union. This was a prospective non-controlled experimental study. Patients were evaluated pre-operatively for necrosis of the proximal scaphoid fragment by radiography, computed tomography (CT) and magnetic resonance imaging (MRI). Vascular status of the proximal scaphoid was determined intra-operatively, demonstrating the presence or absence of puncate bone bleeding. Samples were harvested from the proximal scaphoid fragment and sent for pathological examination. We determined the association between the imaging and intra-operative examination and histological findings. We evaluated 19 male patients diagnosed with scaphoid nonunion. CT evaluation showed no correlation to scaphoid proximal fragment necrosis. MRI showed marked low signal intensity on T1-weighted images that confirmed the histological diagnosis of necrosis in the proximal scaphoid fragment in all patients. Intra-operative assessment showed that 90% of bones had absence of intra-operative puncate bone bleeding, which was confirmed necrosis by microscopic examination. In scaphoid nonunion MRI images with marked low signal intensity on T1-weighted images and the absence of intra-operative puncate bone bleeding are strong indicatives of osteonecrosis of the proximal fragment.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
PURPOSE: To evaluate the sensitivity and specificity of machine learning classifiers (MLCs) for glaucoma diagnosis using Spectral Domain OCT (SD-OCT) and standard automated perimetry (SAP). METHODS: Observational cross-sectional study. Sixty two glaucoma patients and 48 healthy individuals were included. All patients underwent a complete ophthalmologic examination, achromatic standard automated perimetry (SAP) and retinal nerve fiber layer (RNFL) imaging with SD-OCT (Cirrus HD-OCT; Carl Zeiss Meditec Inc., Dublin, California). Receiver operating characteristic (ROC) curves were obtained for all SD-OCT parameters and global indices of SAP. Subsequently, the following MLCs were tested using parameters from the SD-OCT and SAP: Bagging (BAG), Naive-Bayes (NB), Multilayer Perceptron (MLP), Radial Basis Function (RBF), Random Forest (RAN), Ensemble Selection (ENS), Classification Tree (CTREE), Ada Boost M1(ADA),Support Vector Machine Linear (SVML) and Support Vector Machine Gaussian (SVMG). Areas under the receiver operating characteristic curves (aROC) obtained for isolated SAP and OCT parameters were compared with MLCs using OCT+SAP data. RESULTS: Combining OCT and SAP data, MLCs' aROCs varied from 0.777(CTREE) to 0.946 (RAN).The best OCT+SAP aROC obtained with RAN (0.946) was significantly larger the best single OCT parameter (p<0.05), but was not significantly different from the aROC obtained with the best single SAP parameter (p=0.19). CONCLUSION: Machine learning classifiers trained on OCT and SAP data can successfully discriminate between healthy and glaucomatous eyes. The combination of OCT and SAP measurements improved the diagnostic accuracy compared with OCT data alone.
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física