Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Práticas escolares e desempenho acadêmico de alunos com TDAH

This article reports the results from the research work which objects the critical and profound study about the ADHD (Attention Deficit/Hyperactivity Disorder) in the courses for teachers' development in College Education, under its various dimensions - social, cultural, pedagogical, biological. The investigation focused on five adults with diagnosis for ADHD. The methodology used was the Case Study, developed from the Oral History as a source of data. The results that were obtained suggest that the study, proposed in the research, may contribute significantly for the teachers to know determining factors of the school performance of students with this disorder, as well as to guide them in the search of partnership with other professionals - doctors and psychologists, for example - when such partnership becomes necessary.

A moradia estudantil universitária como tema na produção científica nacional

This study analyses the national scientific production about college students' residence halls. The country's main data bases and electronic sites of several Brazilian higher education institutions were checked and 23 studies, published between 2000 and 2009, were found. The results of our analysis point to different focuses, which can be grouped into three categories: students who live in residence halls, residence halls themselves and actions for student assistance. Although there is large foreign scientific production about college student housing, the national production on this theme is still scarce, and the idea of student residence halls as educational spaces is still very incipient. The study points out to the need for investigating the living conditions in these places, and the impacts of this kind of habitation on students. Considering that student housing is an institutional responsibility, these studies potentially subsidize measures for proper educational conditions for college students.

Entre o fogo e o vento : as praticas de batuques e o controle das emoções

Universidade Estadual de Campinas . Faculdade de Educação Física