14 resultados para MICROBIAL INFECTION

em Repositório da Produção Científica e Intelectual da Unicamp


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Revascularization outcome depends on microbial elimination because apical repair will not happen in the presence of infected tissues. This study evaluated the microbial composition of traumatized immature teeth and assessed their reduction during different stages of the revascularization procedures performed with 2 intracanal medicaments. Fifteen patients (7-17 years old) with immature teeth were submitted to the revascularization procedures; they were divided into 2 groups according to the intracanal medicament used: TAP group (n = 7), medicated with a triple antibiotic paste, and CHP group (n = 8), dressed with calcium hydroxide + 2% chlorhexidine gel. Samples were taken before any treatment (S1), after irrigation with 6% NaOCl (S2), after irrigation with 2% chlorhexidine (S3), after intracanal dressing (S4), and after 17% EDTA irrigation (S5). Cultivable bacteria recovered from the 5 stages were counted and identified by means of polymerase chain reaction assay (16S rRNA). Both groups had colony-forming unit counts significantly reduced after S2 (P < .05); however, no significant difference was found between the irrigants (S2 and S3, P = .99). No difference in bacteria counts was found between the intracanal medicaments used (P = .95). The most prevalent bacteria detected were Actinomyces naeslundii (66.67%), followed by Porphyromonas endodontalis, Parvimonas micra, and Fusobacterium nucleatum, which were detected in 33.34% of the root canals. An average of 2.13 species per canal was found, and no statistical correlation was observed between bacterial species and clinical/radiographic features. The microbial profile of infected immature teeth is similar to that of primarily infected permanent teeth. The greatest bacterial reduction was promoted by the irrigation solutions. The revascularization protocols that used the tested intracanal medicaments were efficient in reducing viable bacteria in necrotic immature teeth.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In this work the archaea and eubacteria community of a hypersaline produced water from the Campos Basin that had been transported and discharged to an onshore storage facility was evaluated by 16S recombinant RNA (rRNA) gene sequence analysis. The produced water had a hypersaline salt content of 10 (w/v), had a carbon oxygen demand (COD) of 4,300 mg/l and contains phenol and other aromatic compounds. The high salt and COD content and the presence of toxic phenolic compounds present a problem for conventional discharge to open seawater. In previous studies, we demonstrated that the COD and phenolic content could be largely removed under aerobic conditions, without dilution, by either addition of phenol degrading Haloarchaea or the addition of nutrients alone. In this study our goal was to characterize the microbial community to gain further insight into the persistence of reservoir community members in the produced water and the potential for bioremediation of COD and toxic contaminants. Members of the archaea community were consistent with previously identified communities from mesothermic reservoirs. All identified archaea were located within the phylum Euryarchaeota, with 98 % being identified as methanogens while 2 % could not be affiliated with any known genus. Of the identified archaea, 37 % were identified as members of the strictly carbon-dioxide-reducing genus Methanoplanus and 59 % as members of the acetoclastic genus Methanosaeta. No Haloarchaea were detected, consistent with the need to add these organisms for COD and aromatic removal. Marinobacter and Halomonas dominated the eubacterial community. The presence of these genera is consistent with the ability to stimulate COD and aromatic removal with nutrient addition. In addition, anaerobic members of the phyla Thermotogae, Firmicutes, and unclassified eubacteria were identified and may represent reservoir organisms associated with the conversion hydrocarbons to methane.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Human bocavirus 1 (HBoV1) is associated with respiratory infections worldwide, mainly in children. Similar to other parvoviruses, it is believed that HBoV1 can persist for long periods of time in humans, probably through maintaining concatemers of the virus single-stranded DNA genome in the nuclei of infected cells. Recently, HBoV-1 was detected in high rates in adenoid and palatine tonsils samples from patients with chronic adenotonsillar diseases, but nothing is known about the virus replication levels in those tissues. A 3-year prospective hospital-based study was conducted to detect and quantify HBoV1 DNA and mRNAs in samples of the adenoids (AD), palatine tonsils (PT), nasopharyngeal secretions (NPS), and peripheral blood (PB) from patients undergoing tonsillectomy for tonsillar hypertrophy or recurrent tonsillitis. HBoV1 was detected in 25.3% of the AD samples, while the rates of detection in the PT, NPS, and PB samples were 7.2%, 10.5%, and 1.7%, respectively. The viral loads were higher in AD samples, and 27.3% of the patients with HBoV had mRNA detectable in this tissue. High viral loads and detectable mRNA in the AD were associated with HBoV1 detection in the other sample sites. The adenoids are an important site of HBoV1 replication and persistence in children with tonsillar hypertrophy. The adenoids contain high HBoV1 loads and are frequently positive for HBoV mRNA, and this is associated with the detection of HBoV1 in secretions.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Biofilm formation on reverse osmosis (RO) systems represents a drawback in the application of this technology by different industries, including oil refineries. In RO systems the feed water maybe a source of microbial contamination and thus contributes for the formation of biofilm and consequent biofouling. In this study the planktonic culturable bacterial community was characterized from a feed water of a RO system and their capacities were evaluated to form biofilm in vitro. Bacterial motility and biofilm control were also analysed using phages. As results, diverse Protobacteria, Actinobacteria and Bacteroidetes were identified. Alphaproteobacteria was the predominant group and Brevundimonas, Pseudomonas and Mycobacterium the most abundant genera. Among the 30 isolates, 11 showed at least one type of motility and 11 were classified as good biofilm formers. Additionally, the influence of non-specific bacteriophage in the bacterial biofilms formed in vitro was investigated by action of phages enzymes or phage infection. The vB_AspP-UFV1 (Podoviridae) interfered in biofilm formation of most tested bacteria and may represent a good alternative in biofilm control. These findings provide important information about the bacterial community from the feed water of a RO system that may be used for the development of strategies for biofilm prevention and control in such systems.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Substantial complexity has been introduced into treatment regimens for patients with human immunodeficiency virus (HIV) infection. Many drug-related problems (DRPs) are detected in these patients, such as low adherence, therapeutic inefficacy, and safety issues. We evaluated the impact of pharmacist interventions on CD4+ T-lymphocyte count, HIV viral load, and DRPs in patients with HIV infection. In this 18-month prospective controlled study, 90 outpatients were selected by convenience sampling from the Hospital Dia-University of Campinas Teaching Hospital (Brazil). Forty-five patients comprised the pharmacist intervention group and 45 the control group; all patients had HIV infection with or without acquired immunodeficiency syndrome. Pharmaceutical appointments were conducted based on the Pharmacotherapy Workup method, although DRPs and pharmacist intervention classifications were modified for applicability to institutional service limitations and research requirements. Pharmacist interventions were performed immediately after detection of DRPs. The main outcome measures were DRPs, CD4+ T-lymphocyte count, and HIV viral load. After pharmacist intervention, DRPs decreased from 5.2 (95% confidence interval [CI] =4.1-6.2) to 4.2 (95% CI =3.3-5.1) per patient (P=0.043). A total of 122 pharmacist interventions were proposed, with an average of 2.7 interventions per patient. All the pharmacist interventions were accepted by physicians, and among patients, the interventions were well accepted during the appointments, but compliance with the interventions was not measured. A statistically significant increase in CD4+ T-lymphocyte count in the intervention group was found (260.7 cells/mm(3) [95% CI =175.8-345.6] to 312.0 cells/mm(3) [95% CI =23.5-40.6], P=0.015), which was not observed in the control group. There was no statistical difference between the groups regarding HIV viral load. This study suggests that pharmacist interventions in patients with HIV infection can cause an increase in CD4+ T-lymphocyte counts and a decrease in DRPs, demonstrating the importance of an optimal pharmaceutical care plan.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Rhodotorula glutinis CCT 2182, Rhodosporidium toruloides CCT 0783, Rhodotorula minuta CCT 1751 and Lipomyces starkeyi DSM 70296 were evaluated for the conversion of sugars from Brazilian molasses into single-cell oil (SCO) feedstock for biodiesel. Pulsed fed-batch fermentations were performed in 1.65 l working volume bioreactors. The maximum specific growth rate (µmax), lipid productivity (Pr) and cellular lipid content were, respectively, 0.23 h(-1), 0.41 g l(-1) h(-1), and 41% for Rsp. toruloides; 0.20 h(-1), 0.27 g l(-1) h(-1), and 36% for Rta. glutinis; 0.115 h(-1), 0.135 g l(-1) h(-1), and 27 % for Rta. minuta; and 0.11 h(-1), 0.13 g l(-1) h(-1), and 32% for L. starkeyi. Based on their microbial lipid productivity, content, and profile, Rsp. toruloides and Rta. glutinis are promising candidates for biodiesel production from Brazilian molasses. All the oils from the yeasts were similar to the composition of plant oils (rapeseed and soybean) and could be used as raw material for biofuels, as well as in food and nutraceutical products.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Urinary tract infection (UTI) is the most common infection posttransplant. However, the risk factors for and the impact of UTIs remain controversial. The aim of this study was to identify the incidence of posttransplant UTIs in a series of renal transplant recipients from deceased donors. Secondary objectives were to identify: (1) the most frequent infectious agents; (2) risk factors related to donor; (3) risk factors related to recipients; and (4) impact of UTI on graft function. This was a retrospective analysis of medical records from renal transplant patients from January to December 2010. Local ethics committee approved the protocol. The incidence of UTI in this series was 34.2%. Risk factors for UTI were older age, (independent of gender), biopsy-proven acute rejection episodes, and kidneys from deceased donors (United Network for Organ Sharing criteria). For female patients, the number of pretransplant pregnancies was an additional risk factor. Recurrent UTI was observed in 44% of patients from the UTI group. The most common infectious agents were Escherichia coli and Klebsiella pneumoniae, for both isolated and recurrent UTI. No difference in renal graft function or immunosuppressive therapy was observed between groups after the 1-year follow-up. In this series, older age, previous pregnancy, kidneys from expanded criteria donors, and biopsy-proven acute rejection episodes were risk factors for posttransplant UTI. Recurrence of UTI was observed in 44%, with no negative impact on graft function or survival.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

By comparing the SEED and Pfam functional profiles of metagenomes of two Brazilian coral species with 29 datasets that are publicly available, we were able to identify some functions, such as protein secretion systems, that are overrepresented in the metagenomes of corals and may play a role in the establishment and maintenance of bacteria-coral associations. However, only a small percentage of the reads of these metagenomes could be annotated by these reference databases, which may lead to a strong bias in the comparative studies. For this reason, we have searched for identical sequences (99% of nucleotide identity) among these metagenomes in order to perform a reference-independent comparative analysis, and we were able to identify groups of microbial communities that may be under similar selective pressures. The identification of sequences shared among the metagenomes was found to be even better for the identification of groups of communities with similar niche requirements than the traditional analysis of functional profiles. This approach is not only helpful for the investigation of similarities between microbial communities with high proportion of unknown reads, but also enables an indirect overview of gene exchange between communities.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

To investigate endotoxin levels from primary endodontic infections before and after chemomechanical preparation (CMP) and to determine their antigenicity against 3T3 fibroblasts through gelatinolytic activity of matrix metalloproteinases (MMPs). Twenty-four root canals with primary endodontic infection and apical periodontitis were selected. Samples were collected using paper points before (S1) and after chemomechanical preparation (CMP) (S2). The limulus amebocyte lysate assay was used for endotoxin measurement. Fibroblasts were stimulated with root canal contents for 24 h. Supernatants of cell cultures stimulated with root canal contents were collected after 24 h to determine the levels of MMP-2 and MMP-9 gelatinolytic activity using the zymography technique. Friedman and Wilcoxon tests were used to compare the amount of endotoxin before (S1) and after CMP (S2) (P < 0.05). Data obtained from gelatinolytic activity were analysed using anova and Tukey's tests (P < 0.05). Endotoxin was recovered in 100% of the samples. There was a significant reduction in endotoxin levels after CMP (P < 0.05). A correlation was found between the levels of endotoxins and MMP-2 expression (P < 0.05). Root canal contents of initial samples (S1) induced significantly greater MMP-2 expression by fibroblasts when compared to S2 and the nonstimulated group (P < 0.05). No gelatinolytic activity of MMP-9 was observed in S1, S2 and control group. Root canal contents from primary endodontic infections had gelatinolytic activity for MMP-2. Moreover, CMP was effective in reducing endotoxin levels and their antigenicity against fibroblasts on gelatinolytic activity.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The efficacy of the human papillomavirus type 16 (HPV-16)/HPV-18 AS04-adjuvanted vaccine against cervical infections with HPV in the Papilloma Trial against Cancer in Young Adults (PATRICIA) was evaluated using a combination of the broad-spectrum L1-based SPF10 PCR-DNA enzyme immunoassay (DEIA)/line probe assay (LiPA25) system with type-specific PCRs for HPV-16 and -18. Broad-spectrum PCR assays may underestimate the presence of HPV genotypes present at relatively low concentrations in multiple infections, due to competition between genotypes. Therefore, samples were retrospectively reanalyzed using a testing algorithm incorporating the SPF10 PCR-DEIA/LiPA25 plus a novel E6-based multiplex type-specific PCR and reverse hybridization assay (MPTS12 RHA), which permits detection of a panel of nine oncogenic HPV genotypes (types 16, 18, 31, 33, 35, 45, 52, 58, and 59). For the vaccine against HPV types 16 and 18, there was no major impact on estimates of vaccine efficacy (VE) for incident or 6-month or 12-month persistent infections when the MPTS12 RHA was included in the testing algorithm versus estimates with the protocol-specified algorithm. However, the alternative testing algorithm showed greater sensitivity than the protocol-specified algorithm for detection of some nonvaccine oncogenic HPV types. More cases were gained in the control group than in the vaccine group, leading to higher point estimates of VE for 6-month and 12-month persistent infections for the nonvaccine oncogenic types included in the MPTS12 RHA assay (types 31, 33, 35, 45, 52, 58, and 59). This post hoc analysis indicates that the per-protocol testing algorithm used in PATRICIA underestimated the VE against some nonvaccine oncogenic HPV types and that the choice of the HPV DNA testing methodology is important for the evaluation of VE in clinical trials. (This study has been registered at ClinicalTrials.gov under registration no. NCT00122681.).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Oropouche virus (OROV) is a member of the Orthobunyavirus genus in the Bunyaviridae family and a prominent cause of insect-transmitted viral disease in Central and South America. Despite its clinical relevance, little is known about OROV pathogenesis. To define the host defense pathways that control OROV infection and disease, we evaluated OROV pathogenesis and immune responses in primary cells and mice that were deficient in the RIG-I-like receptor signaling pathway (MDA5, RIG-I, or MAVS), downstream regulatory transcription factors (IRF-3 or IRF-7), IFN-β, or the receptor for type I IFN signaling (IFNAR). OROV replicated to higher levels in primary fibroblasts and dendritic cells lacking MAVS signaling, the transcription factors IRF-3 and IRF-7, or IFNAR. In mice, deletion of IFNAR, MAVS, or IRF-3 and IRF-7 resulted in uncontrolled OROV replication, hypercytokinemia, extensive liver damage, and death whereas wild-type (WT) congenic animals failed to develop disease. Unexpectedly, mice with a selective deletion of IFNAR on myeloid cells (CD11c Cre(+) Ifnar(f/f) or LysM Cre(+) Ifnar(f/f)) did not sustain enhanced disease with OROV or La Crosse virus, a closely related encephalitic orthobunyavirus. In bone marrow chimera studies, recipient irradiated Ifnar(-/-) mice reconstituted with WT hematopoietic cells sustained high levels of OROV replication and liver damage, whereas WT mice reconstituted with Ifnar(-/-) bone marrow were resistant to disease. Collectively, these results establish a dominant protective role for MAVS, IRF-3 and IRF-7, and IFNAR in restricting OROV virus infection and tissue injury, and suggest that IFN signaling in non-myeloid cells contributes to the host defense against orthobunyaviruses. Oropouche virus (OROV) is an emerging arthropod-transmitted orthobunyavirus that causes episodic outbreaks of a debilitating febrile illness in humans in countries of South and Central America. The continued expansion of the range and number of its arthropod vectors increases the likelihood that OROV will spread into new regions. At present, the pathogenesis of OROV in humans or other vertebrate animals remains poorly understood. To define cellular mechanisms of control of OROV infection, we performed infection studies in a series of primary cells and mice that were deficient in key innate immune genes involved in pathogen recognition and control. Our results establish that a MAVS-dependent type I IFN signaling pathway has a dominant role in restricting OROV infection and pathogenesis in vivo.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The behaviour of the albino and melanic variants of Biomphalaria glabrata of Belo Horizonte (MG. Brazil) was studied comparatively, in terms of their respective susceptibilities to infection by Schistosoma mansoni of the same origin, through observation of the elimination of cercariae for a three-month period and the calculation of mortality and infection rates, in control and in infected snails. The number of amoebocytes, granulocytes and hyalinocytes in the circulating hemolymph during different periods of infection was analyzed. The evolution of the infection in the tissues was observed by means of histological cross-sections. The melanic variant showed greater susceptibility to infection and a higher mortality rate. The albino variant showed a higher number of circulating amoebocytes, both granulocytes and hyalinocytes. A higher number of degenerated sporocysts were seen in the histological cross-sections of the albino variant. The results suggest that the melanic variant of B. glabrata was more susceptible to infection by S. mansoni than was the albino variant.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Dry eye disease and ocular surface disorders may be caused or worsened by viral agents. There are several known and suspected virus associated to ocular surface diseases. The possible pathogenic mechanisms for virus-related dry eye disease are presented herein. This review serves to reinforce the importance of ophthalmologists as one of the healthcare professional able to diagnose a potentially large number of infected patients with high prevalent viral agents.