Influence Of Fluorescent Dye On Physical-mechanical Properties Of Luting Cements For Confocal Microscopy Analysis.

To evaluate the influence of a fluorescent dye (rhodamine B) on the physical and mechanical properties of three different luting cements: a conventional adhesive luting cement (RelyX ARC, 3M/ESPE), a self-adhesive luting cement (RelyX U-200, 3M/ESPE), and a self-etching and self-adhesive luting cement (SeT PP, SDI). The cements were mixed with 0.03 wt% rhodamine B, formed into bar-shaped specimens (n = 10), and light cured using an LED curing unit (Radii, SDI) with a radiant exposure of 32 J/cm(2) . The Knoop hardness (KHN), flexural strength (FS), and Young's modulus (YM) analyses were evaluated after storage for 24 h. Outcomes were subjected to two-way ANOVA and Tukey's test (P = 0.05) for multiple comparisons. No significant differences in FS or YM were observed among the tested groups (P ≥ 0.05); the addition of rhodamine B increased the hardness of the luting cements tested. The addition of a fluorescent agent at 0.03 wt% concentration does not negatively affect the physical-mechanical properties of the luting cement polymerization behavior.

An Isoflavone From Dipteryx Alata Vogel Is Active Against The In Vitro Neuromuscular Paralysis Of Bothrops Jararacussu Snake Venom And Bothropstoxin I, And Prevents Venom-induced Myonecrosis.

Snakebite is a neglected disease and serious health problem in Brazil, with most bites being caused by snakes of the genus Bothrops. Although serum therapy is the primary treatment for systemic envenomation, it is generally ineffective in neutralizing the local effects of these venoms. In this work, we examined the ability of 7,8,3'-trihydroxy-4'-methoxyisoflavone (TM), an isoflavone from Dipteryx alata, to neutralize the neurotoxicity (in mouse phrenic nerve-diaphragm preparations) and myotoxicity (assessed by light microscopy) of Bothrops jararacussu snake venom in vitro. The toxicity of TM was assessed using the Salmonella microsome assay (Ames test). Incubation with TM alone (200 μg/mL) did not alter the muscle twitch tension whereas incubation with venom (40 μg/mL) caused irreversible paralysis. Preincubation of TM (200 μg/mL) with venom attenuated the venom-induced neuromuscular blockade by 84% ± 5% (mean ± SEM; n = 4). The neuromuscular blockade caused by bothropstoxin-I (BthTX-I), the major myotoxic PLA2 of this venom, was also attenuated by TM. Histological analysis of diaphragm muscle incubated with TM showed that most fibers were preserved (only 9.2% ± 1.7% were damaged; n = 4) compared to venom alone (50.3% ± 5.4% of fibers damaged; n = 3), and preincubation of TM with venom significantly attenuated the venom-induced damage (only 17% ± 3.4% of fibers damaged; n = 3; p < 0.05 compared to venom alone). TM showed no mutagenicity in the Ames test using Salmonella strains TA98 and TA97a with (+S9) and without (-S9) metabolic activation. These findings indicate that TM is a potentially useful compound for antagonizing the neuromuscular effects (neurotoxicity and myotoxicity) of B. jararacussu venom.

Caracterização morfoanatômica e histoquímica de Cuphea carthagenensis (Jacq.) J.f. Macbr. (Lythraceae)

Cuphea carthagenensis (Jacq.) J.F. Macbr. is an herb, which occurs preferably in wet places. Amongst other species of the genus, C. carthagenensis is distinguished for its great chemical potential and frequent use in popular medicine. In this study the morphological and anatomical structures were identified, as well as the histochemical characterization was done. Samples of root, stem and leaves were collected from adult plants. This material was processed for anatomical and histochemical analysis in light microscopy and for morphological analysis, in scanning electron microscopy. Important morphological and anatomical considerations were added for C. carthagenensis, such as: the occurrence of aerenchymatous phellem with suberized layers; the types of trichomes present in the vegetative organs, the characterization of secretory trichomes, as well as the secreted substances. The groups of secondary metabolites presents in the root, stem and leaf of C. carthagenensis with more intense histochemical reaction were: proanthocyanidins, phenolic compounds, acids polysaccharides (mucilage especially) and lipids.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Overexpression Of Ucp1 In Tobacco Induces Mitochondrial Biogenesis And Amplifies A Broad Stress Response.

Uncoupling protein one (UCP1) is a mitochondrial inner membrane protein capable of uncoupling the electrochemical gradient from adenosine-5'-triphosphate (ATP) synthesis, dissipating energy as heat. UCP1 plays a central role in nonshivering thermogenesis in the brown adipose tissue (BAT) of hibernating animals and small rodents. A UCP1 ortholog also occurs in plants, and aside from its role in uncoupling respiration from ATP synthesis, thereby wasting energy, it plays a beneficial role in the plant response to several abiotic stresses, possibly by decreasing the production of reactive oxygen species (ROS) and regulating cellular redox homeostasis. However, the molecular mechanisms by which UCP1 is associated with stress tolerance remain unknown. Here, we report that the overexpression of UCP1 increases mitochondrial biogenesis, increases the uncoupled respiration of isolated mitochondria, and decreases cellular ATP concentration. We observed that the overexpression of UCP1 alters mitochondrial bioenergetics and modulates mitochondrial-nuclear communication, inducing the upregulation of hundreds of nuclear- and mitochondrial-encoded mitochondrial proteins. Electron microscopy analysis showed that these metabolic changes were associated with alterations in mitochondrial number, area and morphology. Surprisingly, UCP1 overexpression also induces the upregulation of hundreds of stress-responsive genes, including some involved in the antioxidant defense system, such as superoxide dismutase (SOD), glutathione peroxidase (GPX) and glutathione-S-transferase (GST). As a consequence of the increased UCP1 activity and increased expression of oxidative stress-responsive genes, the UCP1-overexpressing plants showed reduced ROS accumulation. These beneficial metabolic effects may be responsible for the better performance of UCP1-overexpressing lines in low pH, high salt, high osmolarity, low temperature, and oxidative stress conditions. Overexpression of UCP1 in the mitochondrial inner membrane induced increased uncoupling respiration, decreased ROS accumulation under abiotic stresses, and diminished cellular ATP content. These events may have triggered the expression of mitochondrial and stress-responsive genes in a coordinated manner. Because these metabolic alterations did not impair plant growth and development, UCP1 overexpression can potentially be used to create crops better adapted to abiotic stress conditions.

Fine Needle Aspiration Cytology In The Diagnosis Of Perioral Adverse Reactions To Cosmetic Dermal Fillers.

Facial cosmetic procedures are increasingly requested, and dermal filler materials have been widely used as a nonsurgical option since the 1980s. However, injectable fillers have been implicated in local adverse reactions. Therefore, the aim of this article was to describe the use of fine needle aspiration cytology (FNAC) in the diagnosis of foreign-body reactions to the perioral injection of dermal fillers. A 69-year-old woman presented with a painful nodule on her right nasolabial fold. Intraoral FNAC was performed, and cytologic smears were examined under optical and polarized light microscopy, showing birefringent microspheres, confirming the diagnosis of an adverse reaction caused by polymethyl methacrylate filler. FNAC is a less invasive method to confirm the diagnosis of adverse reactions caused by perioral cosmetic dermal fillers.

Trichomes Related To An Unusual Method Of Water Retention And Protection Of The Stem Apex In An Arid Zone Perennial Species.

It is well known that trichomes protect plant organs, and several studies have investigated their role in the adaptation of plants to harsh environments. Recent studies have shown that the production of hydrophilic substances by glandular trichomes and the deposition of this secretion on young organs may facilitate water retention, thus preventing desiccation and favouring organ growth until the plant develops other protective mechanisms. Lychnophora diamantinana is a species endemic to the Brazilian 'campos rupestres' (rocky fields), a region characterized by intense solar radiation and water deficits. This study sought to investigate trichomes and the origin of the substances observed on the stem apices of L. diamantinana. Samples of stem apices, young and expanded leaves were studied using standard techniques, including light microscopy and scanning and transmission electron microscopy. Histochemical tests were used to identify the major groups of metabolites present in the trichomes and the hyaline material deposited on the apices. Non-glandular trichomes and glandular trichomes were observed. The material deposited on the stem apices was hyaline, highly hydrophilic and viscous. This hyaline material primarily consists of carbohydrates that result from the partial degradation of the cell wall of uniseriate trichomes. This degradation occurs at the same time that glandular trichomes secrete terpenoids, phenolic compounds and proteins. These results suggest that the non-glandular trichomes on the leaves of L. diamantinana help protect the young organ, particularly against desiccation, by deposition of highly hydrated substances on the apices. Furthermore, the secretion of glandular trichomes probably repels herbivore and pathogen attacks.

Pigmented Ameloblastic Fibro-odontoma: Clinical, Histological, And Immunohistochemical Profile.

Ameloblastic fibro-odontoma (AFO) is a slow-growing, expansive, benign odontogenic tumor, composed of ameloblastic epithelium embedded in an ectomesenchymal stroma resembling dental papilla, containing hard dental tissue in variable degrees of maturation, including enamel, dentin, and sometimes cementum. AFO typically affects the posterior mandible, causing bony expansion. We report a case of pigmented AFO in a 5-year-old boy, comprising clinical and histological features illustrated by immunohistochemistry using a large panel of antibodies, polarized light microscopy and scanning electron microscopy.

Microencapsulação de óleo essencial de laranja

It was done microencapsulation of natural essencial orange oil through spray-drying. The purpose was to use the best proportion of wall materials among maltodextrin, acacia gum, and modified starch (capsul) in order to retain greater amount of orange oil. The orange oil (10%) and maltodextrin (36%) remained constant. Three spray drying temperatures were employed: 180°C, 200°C and 220°C, therefore, nine final products were obtained. The superficial and inner oil concentrations were measured. The microcapsules were also examined through optical and scanning electron microscopy. The three temperatures employed did not affect the microencapsulation. The microstructure of the capsules were almost similar regardless the proportion employed among the carbohydrates to wall composition. At light microscopy it was observed a great heterogeneity of capsules diameters, and probably not smooth surfaces; at scanning electron microscopy it was clear that the walls displayed porosity over round surfaces. The best retention was given by the formula containing 10% of capsul, 10% of orange oil and 36% of maltodextrin, when total oil retention was 94%, regardless the drying temperature here employed.