4 resultados para Large-scale Testing
em Repositório da Produção Científica e Intelectual da Unicamp
Biased Random-key Genetic Algorithms For The Winner Determination Problem In Combinatorial Auctions.
Resumo:
Abstract In this paper, we address the problem of picking a subset of bids in a general combinatorial auction so as to maximize the overall profit using the first-price model. This winner determination problem assumes that a single bidding round is held to determine both the winners and prices to be paid. We introduce six variants of biased random-key genetic algorithms for this problem. Three of them use a novel initialization technique that makes use of solutions of intermediate linear programming relaxations of an exact mixed integer-linear programming model as initial chromosomes of the population. An experimental evaluation compares the effectiveness of the proposed algorithms with the standard mixed linear integer programming formulation, a specialized exact algorithm, and the best-performing heuristics proposed for this problem. The proposed algorithms are competitive and offer strong results, mainly for large-scale auctions.
Resumo:
After a long incubation period, the Intergovernmental Platform on Biodiversity and Ecosystem Services (IPBES) is now underway. Underpinning all its activities is the IPBES Conceptual Framework (CF), a simplified model of the interactions between nature and people. Drawing on the legacy of previous large-scale environmental assessments, the CF goes further in explicitly embracing different disciplines and knowledge systems (including indigenous and local knowledge) in the co-construction of assessments of the state of the world's biodiversity and the benefits it provides to humans. The CF can be thought of as a kind of Rosetta Stone that highlights commonalities between diverse value sets and seeks to facilitate crossdisciplinary and crosscultural understanding. We argue that the CF will contribute to the increasing trend towards interdisciplinarity in understanding and managing the environment. Rather than displacing disciplinary science, however, we believe that the CF will provide new contexts of discovery and policy applications for it.
Resumo:
Cecropia glaziovii is a tree with used in Brazilian popular medicine. Methods allowing the clonal propagation of this species are of great interest for superior genotype multiplication and perpetuation. For this reason, we examined the effect of different culture media and different types of explants on adventitious shoot regeneration from callus and buds of C. glaziovii. Leaves, petioles and stipules obtained from aseptically grown seedlings or from pre-sterilized plants were used to initiate cultures. Adventitious shoot regeneration was achieved when apical and axillary buds were inoculated on gelled Murashige & Skoog (MS) medium supplemented with 6-benzylaminopurine alone (BAP) (1.0, 5.0 or 10.0 mg L-1) or combined with -naphthalene acetic acid (NAA) (1.0 or 2.0 mg L-1), after 40 days of culture. Best callus production was obtained after 30 days of petioles' culture on gelled MS medium with 2,4 dichlorophenoxyacetic acid (2,4-D) (5.0 mg L-1) combined with BAP (1.0 mg L-1). Successful shoot regeneration from callus was achieved when MS medium supplemented with zeatin (ZEA) (0.1 mg L-1) alone or combined with 2,4-D (1.0 or 5.0 mg L-1) was inoculated with friable callus obtained from petioles. All shoots were rooted by inoculation on MS medium supplemented with indole-3-acetic acid (IAA) (1.0 mg L-1). Rooted plants transferred to potting soil were successfully established. All in vitro regenerated plantlets showed to be normal, without morphological variations, being also identical to the source plant. Our study has shown that C. glaziovii can be propagated by tissue culture methods, allowing large scale multiplication of superior plants for pharmacological purposes.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.