1 resultado para Large-scale Analysis
em Repositório da Produção Científica e Intelectual da Unicamp
Filtro por publicador
- KUPS-Datenbank - Universität zu Köln - Kölner UniversitätsPublikationsServer (1)
- Repository Napier (2)
- Aberdeen University (3)
- Academic Archive On-line (Stockholm University; Sweden) (1)
- Academic Research Repository at Institute of Developing Economies (3)
- Acceda, el repositorio institucional de la Universidad de Las Palmas de Gran Canaria. España (1)
- Adam Mickiewicz University Repository (2)
- AMS Tesi di Dottorato - Alm@DL - Università di Bologna (31)
- AMS Tesi di Laurea - Alm@DL - Università di Bologna (5)
- ArchiMeD - Elektronische Publikationen der Universität Mainz - Alemanha (3)
- Archive of European Integration (3)
- Archivo Digital para la Docencia y la Investigación - Repositorio Institucional de la Universidad del País Vasco (1)
- Aston University Research Archive (55)
- Biblioteca Digital da Produção Intelectual da Universidade de São Paulo (18)
- Biblioteca Digital da Produção Intelectual da Universidade de São Paulo (BDPI/USP) (45)
- Biblioteca Virtual del Sistema Sanitario Público de Andalucía (BV-SSPA), Junta de Andalucía. Consejería de Salud y Bienestar Social, Spain (2)
- Biodiversity Heritage Library, United States (1)
- BORIS: Bern Open Repository and Information System - Berna - Suiça (82)
- Brock University, Canada (3)
- Bucknell University Digital Commons - Pensilvania - USA (1)
- CentAUR: Central Archive University of Reading - UK (98)
- CiencIPCA - Instituto Politécnico do Cávado e do Ave, Portugal (2)
- Cochin University of Science & Technology (CUSAT), India (1)
- Coffee Science - Universidade Federal de Lavras (2)
- Collection Of Biostatistics Research Archive (1)
- Consorci de Serveis Universitaris de Catalunya (CSUC), Spain (18)
- CORA - Cork Open Research Archive - University College Cork - Ireland (2)
- CUNY Academic Works (3)
- Dalarna University College Electronic Archive (4)
- Department of Computer Science E-Repository - King's College London, Strand, London (2)
- Digital Commons - Michigan Tech (7)
- Digital Commons @ DU | University of Denver Research (1)
- Digital Commons at Florida International University (12)
- Digital Peer Publishing (1)
- Digital Repository at Iowa State University (1)
- DigitalCommons@The Texas Medical Center (8)
- DigitalCommons@University of Nebraska - Lincoln (1)
- Doria (National Library of Finland DSpace Services) - National Library of Finland, Finland (25)
- DRUM (Digital Repository at the University of Maryland) (4)
- Duke University (2)
- Earth Simulator Research Results Repository (1)
- Ecology and Society (1)
- eResearch Archive - Queensland Department of Agriculture; Fisheries and Forestry (1)
- Glasgow Theses Service (1)
- Greenwich Academic Literature Archive - UK (1)
- Illinois Digital Environment for Access to Learning and Scholarship Repository (1)
- Institute of Public Health in Ireland, Ireland (1)
- Instituto Gulbenkian de Ciência (1)
- Instituto Nacional de Saúde de Portugal (2)
- Instituto Politécnico de Leiria (1)
- Instituto Politécnico do Porto, Portugal (21)
- Iowa Publications Online (IPO) - State Library, State of Iowa (Iowa), United States (1)
- Martin Luther Universitat Halle Wittenberg, Germany (5)
- Massachusetts Institute of Technology (2)
- Memorial University Research Repository (1)
- National Center for Biotechnology Information - NCBI (19)
- Nottingham eTheses (1)
- Portal do Conhecimento - Ministerio do Ensino Superior Ciencia e Inovacao, Cape Verde (1)
- Publishing Network for Geoscientific & Environmental Data (14)
- QSpace: Queen's University - Canada (3)
- QUB Research Portal - Research Directory and Institutional Repository for Queen's University Belfast (9)
- Repositório Científico da Universidade de Évora - Portugal (2)
- Repositório Científico do Instituto Politécnico de Lisboa - Portugal (7)
- Repositório da Produção Científica e Intelectual da Unicamp (1)
- Repositório da Universidade Federal do Espírito Santo (UFES), Brazil (1)
- Repositório Institucional UNESP - Universidade Estadual Paulista "Julio de Mesquita Filho" (29)
- Research Open Access Repository of the University of East London. (2)
- RUN (Repositório da Universidade Nova de Lisboa) - FCT (Faculdade de Cienecias e Technologia), Universidade Nova de Lisboa (UNL), Portugal (18)
- SAPIENTIA - Universidade do Algarve - Portugal (1)
- Savoirs UdeS : plateforme de diffusion de la production intellectuelle de l’Université de Sherbrooke - Canada (1)
- School of Medicine, Washington University, United States (1)
- Scielo Saúde Pública - SP (21)
- SerWisS - Server für Wissenschaftliche Schriften der Fachhochschule Hannover (1)
- Universidad de Alicante (4)
- Universidad Politécnica de Madrid (29)
- Universidade Complutense de Madrid (4)
- Universidade do Minho (14)
- Universidade dos Açores - Portugal (2)
- Universidade Estadual Paulista "Júlio de Mesquita Filho" (UNESP) (2)
- Universidade Federal do Rio Grande do Norte (UFRN) (3)
- Universitat de Girona, Spain (6)
- Université de Lausanne, Switzerland (93)
- Université de Montréal (1)
- Université de Montréal, Canada (5)
- University of Canberra Research Repository - Australia (1)
- University of Michigan (20)
- University of Queensland eSpace - Australia (58)
- University of Southampton, United Kingdom (1)
- University of Washington (5)
- WestminsterResearch - UK (1)
- Worcester Research and Publications - Worcester Research and Publications - UK (1)
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.