6 resultados para LIDAR (light detection and ranging)

em Repositório da Produção Científica e Intelectual da Unicamp


Relevância:

100.00% 100.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

It is well known that trichomes protect plant organs, and several studies have investigated their role in the adaptation of plants to harsh environments. Recent studies have shown that the production of hydrophilic substances by glandular trichomes and the deposition of this secretion on young organs may facilitate water retention, thus preventing desiccation and favouring organ growth until the plant develops other protective mechanisms. Lychnophora diamantinana is a species endemic to the Brazilian 'campos rupestres' (rocky fields), a region characterized by intense solar radiation and water deficits. This study sought to investigate trichomes and the origin of the substances observed on the stem apices of L. diamantinana. Samples of stem apices, young and expanded leaves were studied using standard techniques, including light microscopy and scanning and transmission electron microscopy. Histochemical tests were used to identify the major groups of metabolites present in the trichomes and the hyaline material deposited on the apices. Non-glandular trichomes and glandular trichomes were observed. The material deposited on the stem apices was hyaline, highly hydrophilic and viscous. This hyaline material primarily consists of carbohydrates that result from the partial degradation of the cell wall of uniseriate trichomes. This degradation occurs at the same time that glandular trichomes secrete terpenoids, phenolic compounds and proteins. These results suggest that the non-glandular trichomes on the leaves of L. diamantinana help protect the young organ, particularly against desiccation, by deposition of highly hydrated substances on the apices. Furthermore, the secretion of glandular trichomes probably repels herbivore and pathogen attacks.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

A capillary zone electrophoresis (CE) method was developed for the determination of the biocide 2,2-dibromo-3-nitrilo-propionamide (DBNPA) in water used in cooling systems. The biocide is indirectly determined by CE measurement of the concentration of bromide ions produced by the reaction between the DBNPA and bisulfite. The relationship between the bromide peak areas and the DBNPA concentrations showed a good linearity and a coefficient of determination (R(2)) of 0.9997 in the evaluated concentration range of 0-75 μmol L(-1). The detection and quantification limits for DBNPA were 0.23 and 0.75 μmol L(-1), respectively. The proposed CE method was successfully applied for the analysis of samples of tap water and cooling water spiked with DBNPA. The intra-day and inter-day (intermediary) precisions were lower than 2.8 and 6.2%, respectively. The DBNPA concentrations measured by the CE method were compared to the values obtained by a spectrophotometric method and were found to agree well.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Ameloblastic fibro-odontoma (AFO) is a slow-growing, expansive, benign odontogenic tumor, composed of ameloblastic epithelium embedded in an ectomesenchymal stroma resembling dental papilla, containing hard dental tissue in variable degrees of maturation, including enamel, dentin, and sometimes cementum. AFO typically affects the posterior mandible, causing bony expansion. We report a case of pigmented AFO in a 5-year-old boy, comprising clinical and histological features illustrated by immunohistochemistry using a large panel of antibodies, polarized light microscopy and scanning electron microscopy.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

A simple analytical method for extraction and quantification of lutein colorant added to yogurt was developed and validated. The method allowed complete extraction of carotenoids using tetrahydrofuran in vortex, followed by centrifugation, partition to diethyl ether/petroleum ether, and drying. The carotenoids dissolved in ethanol were quantified by UV-Vis spectrophotometry. This method showed linearity in the range tested (1.41-13.42 µg g-1), limits of detection and quantification of 0.42 and 1.28 µg g-1, respectively, low relative standard deviation (3.4%) and recovery ranging from 95 to 103%. The method proved reliable for quantification of lutein added to yogurt.