9 resultados para LARGE-STRAIN DEFORMATION
em Repositório da Produção Científica e Intelectual da Unicamp
Resumo:
The actinobacterium Streptomyces wadayamensis A23 is an endophyte of Citrus reticulata that produces the antimycin and mannopeptimycin antibiotics, among others. The strain has the capability to inhibit Xylella fastidiosa growth. The draft genome of S. wadayamensis A23 has ~7.0 Mb and 6,006 protein-coding sequences, with a 73.5% G+C content.
Resumo:
A Bacillus cereus strain, FT9, isolated from a hot spring in the midwest region of Brazil, had its entire genome sequenced.
Resumo:
In this work we report new silicon and germanium tubular nanostructures with no corresponding stable carbon analogues. The electronic and mechanical properties of these new tubes were investigated through ab initio methods. Our results show that these structures have lower energy than their corresponding nanoribbon structures and are stable up to high temperatures (500 and 1000 K, for silicon and germanium tubes, respectively). Both tubes are semiconducting with small indirect band gaps, which can be significantly altered by both compressive and tensile strains. Large bandgap variations of almost 50% were observed for strain rates as small as 3%, suggesting their possible applications in sensor devices. They also present high Young's modulus values (0.25 and 0.15 TPa, respectively). TEM images were simulated to help in the identification of these new structures.
Resumo:
A proper cast is essential for a successful rehabilitation with implant prostheses, in order to produce better structures and induce less strain on the implants. The aim of this study was to evaluate the precision of four different mold filling techniques and verify an accurate methodology to evaluate these techniques. A total of 40 casts were obtained from a metallic matrix simulating three unit implant-retained prostheses. The molds were filled using four different techniques in four groups (n = 10): Group 1 - Single-portion filling technique; Group 2 - Two-step filling technique; Group 3 - Latex cylinder technique; Group 4 - Joining the implant analogs previously to the mold filling. A titanium framework was obtained and used as a reference to evaluate the marginal misfit and tension forces in each cast. Vertical misfit was measured with an optical microscope with an increase of 120 times following the single-screw test protocol. Strain was quantified using strain gauges. Data were analyzed using one-way ANOVA (Tukey's test) (α =0.05). The correlation between strain and vertical misfit was evaluated by Pearson test. The misfit values did not present statistical difference (P = 0.979), while the strain results showed statistical difference between Groups 3 and 4 (P = 0.027). The splinting technique was considered to be as efficient as the conventional technique. The strain gauge methodology was accurate for strain measurements and cast distortion evaluation. There was no correlation between strain and marginal misfit.
Resumo:
Many Bacillus species can produce biosurfactant, although most of the studies on lipopeptide production by this genus have been focused on Bacillus subtilis. Surfactants are broadly used in pharmaceutical, food and petroleum industry, and biological surfactant shows some advantages over the chemical surfactants, such as less toxicity, production from renewable, cheaper feedstocks and development of novel recombinant hyperproducer strains. This study is aimed to unveil the biosurfactant metabolic pathway and chemical composition in Bacillus safensis strain CCMA-560. The whole genome of the CCMA-560 strain was previously sequenced, and with the aid of bioinformatics tools, its biosurfactant metabolic pathway was compared to other pathways of closely related species. Fourier transform infrared (FTIR) and high-resolution TOF mass spectrometry (MS) were used to characterize the biosurfactant molecule. B. safensis CCMA-560 metabolic pathway is similar to other Bacillus species; however, some differences in amino acid incorporation were observed, and chemical analyses corroborated the genetic results. The strain CCMA-560 harbours two genes flanked by srfAC and srfAD not present in other Bacillus spp., which can be involved in the production of the analogue gramicidin. FTIR and MS showed that B. safensis CCMA-560 produces a mixture of at least four lipopeptides with seven amino acids incorporated and a fatty acid chain with 14 carbons, which makes this molecule similar to the biosurfactant of Bacillus pumilus, namely, pumilacidin. This is the first report on the biosurfactant production by B. safensis, encompassing the investigation of the metabolic pathway and chemical characterization of the biosurfactant molecule.
Resumo:
The aim of this study was to analyze the reasons for missed appointments in dental Family Health Units (FHU) and implement strategies to reduce same through action research. This is a study conducted in 12 FHUs in Piracicaba in the State of São Paulo from January, 1 to December, 31 2010. The sample was composed of 385 users of these health units who were interviewed over the phone and asked about the reasons for missing dental appointments, as well as 12 dentists and 12 nurses. Two workshops were staged with professionals: the first to assess the data collected in interviews and develop strategy, and the second for evaluation after 4 months. The primary cause for missed appointments was the opening hours of the units coinciding with the work schedule of the users. Among the strategies suggested were lectures on oral health, ongoing education in team meetings, training of Community Health Agents, participation in therapeutic groups and partnerships between Oral Health Teams and the social infrastructure of the community. The adoption of the single medical record was the strategy proposed by professionals. The strategies implemented led to a 66.6% reduction in missed appointments by the units and the motivating nature of the workshops elicited critical reflection to redirect health practices.
Resumo:
Avian Pathogenic Escherichia coli (APEC) strains are extra-intestinal E. coli that infect poultry and cause diseases. Nitrite is a central branch-point in bacterial nitrogen metabolism and is used as a cytotoxin by macrophages. Unlike nitric oxide (NO), nitrite cannot diffuse across bacterial membrane cells. The NirC protein acts as a specific channel to facilitate the transport of nitrite into Salmonella and E. coli cells for nitrogen metabolism and cytoplasmic detoxification. NirC is also required for the pathogenicity of Salmonella by downregulating the production of NO by the host macrophages. Based on an in vitro microarray that revealed the overexpression of the nirC gene in APEC strain SCI-07, we constructed a nirC-deficient SCI-07 strain (ΔnirC) and evaluated its virulence potential using in vivo and in vitro assays. The final cumulative mortalities caused by mutant and wild-type (WT) were similar; while the ΔnirC caused a gradual increase in the mortality rate during the seven days recorded, the WT caused mortality up to 24h post-infection (hpi). Counts of the ΔnirC cells in the spleen, lung and liver were higher than those of the WT after 48 hpi but similar at 24 hpi. Although similar number of ΔnirC and WT cells was observed in macrophages at 3 hpi, there was higher number of ΔnirC cells at 16 hpi. The cell adhesion ability of the ΔnirC strain was about half the WT level in the presence and absence of alpha-D-mannopyranoside. These results indicate that the nirC gene influences the pathogenicity of SCI-07 strain.
Resumo:
Spinocerebellar ataxia type 1 (SCA1), spinocerebellar ataxia type 2 (SCA2) and Machado-Joseph disease or spinocerebellar ataxia type 3 (MJD/SCA3) are three distinctive forms of autosomal dominant spinocerebellar ataxia (SCA) caused by expansions of an unstable CAG repeat localized in the coding region of the causative genes. Another related disease, dentatorubropallidoluysian atrophy (DRPLA) is also caused by an unstable triplet repeat and can present as SCA in late onset patients. We investigated the frequency of the SCA1, SCA2, MJD/SCA3 and DRPLA mutations in 328 Brazilian patients with SCA, belonging to 90 unrelated families with various patterns of inheritance and originating in different geographic regions of Brazil. We found mutations in 35 families (39%), 32 of them with a clear autosomal dominant inheritance. The frequency of the SCA1 mutation was 3% of all patients; and 6 % in the dominantly inherited SCAs. We identified the SCA2 mutation in 6% of all families and in 9% of the families with autosomal dominant inheritance. The MJD/SCA3 mutation was detected in 30 % of all patients; and in the 44% of the dominantly inherited cases. We found no DRPLA mutation. In addition, we observed variability in the frequency of the different mutations according to geographic origin of the patients, which is probably related to the distinct colonization of different parts of Brazil. These results suggest that SCA may be occasionally caused by the SCA1 and SCA2 mutations in the Brazilian population, and that the MJD/SCA3 mutation is the most common cause of dominantly inherited SCA in Brazil.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.