14 resultados para Intrusion Detection Systems

em Repositório da Produção Científica e Intelectual da Unicamp


Relevância:

80.00% 80.00%

Publicador:

Resumo:

Chromatography combined with several different detection systems is one of the more used and better performing analytical tools. Chromatography with tandem mass spectrometric detection gives highly selective and sensitive analyses and permits obtaining structural information about the analites and about their molar masses. Due to these characteristics, this analytical technique is very efficient when used to detect substances at trace levels in complex matrices. In this paper we review instrumental and technical aspects of chromatography-tandem mass spectrometry and the state of the art of the technique as it is applied to analysis of toxic substances in food.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The development and maintenance of the sealing of the root canal system is the key to the success of root canal treatment. The resin-based adhesive material has the potential to reduce the microleakage of the root canal because of its adhesive properties and penetration into dentinal walls. Moreover, the irrigation protocols may have an influence on the adhesiveness of resin-based sealers to root dentin. The objective of the present study was to evaluate the effect of different irrigant protocols on coronal bacterial microleakage of gutta-percha/AH Plus and Resilon/Real Seal Self-etch systems. One hundred ninety pre-molars were used. The teeth were divided into 18 experimental groups according to the irrigation protocols and filling materials used. The protocols used were: distilled water; sodium hypochlorite (NaOCl)+eDTA; NaOCl+H3PO4; NaOCl+eDTA+chlorhexidine (CHX); NaOCl+H3PO4+CHX; CHX+eDTA; CHX+ H3PO4; CHX+eDTA+CHX and CHX+H3PO4+CHX. Gutta-percha/AH Plus or Resilon/Real Seal Se were used as root-filling materials. The coronal microleakage was evaluated for 90 days against Enterococcus faecalis. Data were statistically analyzed using Kaplan-Meier survival test, Kruskal-Wallis and Mann-Whitney tests. No significant difference was verified in the groups using chlorhexidine or sodium hypochlorite during the chemo-mechanical preparation followed by eDTA or phosphoric acid for smear layer removal. The same results were found for filling materials. However, the statistical analyses revealed that a final flush with 2% chlorhexidine reduced significantly the coronal microleakage. A final flush with 2% chlorhexidine after smear layer removal reduces coronal microleakage of teeth filled with gutta-percha/AH Plus or Resilon/Real Seal SE.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

To evaluate the effectiveness of Reciproc for the removal of cultivable bacteria and endotoxins from root canals in comparison with multifile rotary systems. The root canals of forty human single-rooted mandibular pre-molars were contaminated with an Escherichia coli suspension for 21 days and randomly assigned to four groups according to the instrumentation system: GI - Reciproc (VDW); GII - Mtwo (VDW); GIII - ProTaper Universal (Dentsply Maillefer); and GIV -FKG Race(™) (FKG Dentaire) (n = 10 per group). Bacterial and endotoxin samples were taken with a sterile/apyrogenic paper point before (s1) and after instrumentation (s2). Culture techniques determined the colony-forming units (CFU) and the Limulus Amebocyte Lysate assay was used for endotoxin quantification. Results were submitted to paired t-test and anova. At s1, bacteria and endotoxins were recovered in 100% of the root canals investigated (40/40). After instrumentation, all systems were associated with a highly significant reduction of the bacterial load and endotoxin levels, respectively: GI - Reciproc (99.34% and 91.69%); GII - Mtwo (99.86% and 83.11%); GIII - ProTaper (99.93% and 78.56%) and GIV - FKG Race(™) (99.99% and 82.52%) (P < 0.001). No statistical difference were found amongst the instrumentation systems regarding bacteria and endotoxin removal (P > 0.01). The reciprocating single file, Reciproc, was as effective as the multifile rotary systems for the removal of bacteria and endotoxins from root canals.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The aim of this study was to evaluate by photoelastic analysis stress distribution on short and long implants of two dental implant systems with 2-unit implant-supported fixed partial prostheses of 8 mm and 13 mm heights. Sixteen photoelastic models were divided into 4 groups: I: long implant (5 × 11 mm) (Neodent), II: long implant (5 × 11 mm) (Bicon), III: short implant (5 × 6 mm) (Neodent), and IV: short implants (5 × 6 mm) (Bicon). The models were positioned in a circular polariscope associated with a cell load and static axial (0.5 Kgf) and nonaxial load (15°, 0.5 Kgf) were applied to each group for both prosthetic crown heights. Three-way ANOVA was used to compare the factors implant length, crown height, and implant system (α = 0.05). The results showed that implant length was a statistically significant factor for both axial and nonaxial loading. The 13 mm prosthetic crown did not result in statistically significant differences in stress distribution between the implant systems and implant lengths studied, regardless of load type (P > 0.05). It can be concluded that short implants showed higher stress levels than long implants. Implant system and length was not relevant factors when prosthetic crown height were increased.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Paper has become increasingly recognized as a very interesting substrate for the construction of microfluidic devices, with potential application in a variety of areas, including health diagnosis, environmental monitoring, immunoassays and food safety. The aim of this review is to present a short history of analytical systems constructed from paper, summarize the main advantages and disadvantages of fabrication techniques, exploit alternative methods of detection such as colorimetric, electrochemical, photoelectrochemical, chemiluminescence and electrochemiluminescence, as well as to take a closer look at the novel achievements in the field of bioanalysis published during the last 2 years. Finally, the future trends for production of such devices are discussed.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This study evaluated the dentine bond strength (BS) and the antibacterial activity (AA) of six adhesives against strict anaerobic and facultative bacteria. Three adhesives containing antibacterial components (Gluma 2Bond (glutaraldehyde)/G2B, Clearfil SE Protect (MDPB)/CSP and Peak Universal Bond (PUB)/chlorhexidine) and the same adhesive versions without antibacterial agents (Gluma Comfort Bond/GCB, Clearfil SE Bond/CSB and Peak LC Bond/PLB) were tested. The AA of adhesives and control groups was evaluated by direct contact method against four strict anaerobic and four facultative bacteria. After incubation, according to the appropriate periods of time for each microorganism, the time to kill microorganisms was measured. For BS, the adhesives were applied according to manufacturers' recommendations and teeth restored with composite. Teeth (n=10) were sectioned to obtain bonded beams specimens, which were tested after artificial saliva storage for one week and one year. BS data were analyzed using two-way ANOVA and Tukey test. Saliva storage for one year reduces the BS only for GCB. In general G2B and GCB required at least 24h for killing microorganisms. PUB and PLB killed only strict anaerobic microorganisms after 24h. For CSP the average time to eliminate the Streptococcus mutans and strict anaerobic oral pathogens was 30min. CSB showed no AA against facultative bacteria, but had AA against some strict anaerobic microorganisms. Storage time had no effect on the BS for most of the adhesives. The time required to kill bacteria depended on the type of adhesive and never was less than 10min. Most of the adhesives showed stable bond strength after one year and the Clearfil SE Protect may be a good alternative in restorative procedures performed on dentine, considering its adequate bond strength and better antibacterial activity.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This paper presents the state of the art of self-etch adhesive systems. Four topics are shown in this review and included: the historic of this category of bonding agents, bonding mechanism, characteristics/properties and the formation of acid-base resistant zone at enamel/dentin-adhesive interfaces. Also, advantages regarding etch-and-rinse systems and classifications of self-etch adhesive systems according to the number of steps and acidity are addressed. Finally, issues like the potential durability and clinical importance are discussed. Self-etch adhesive systems are promising materials because they are easy to use, bond chemically to tooth structure and maintain the dentin hydroxyapatite, which is important for the durability of the bonding.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A capillary zone electrophoresis (CE) method was developed for the determination of the biocide 2,2-dibromo-3-nitrilo-propionamide (DBNPA) in water used in cooling systems. The biocide is indirectly determined by CE measurement of the concentration of bromide ions produced by the reaction between the DBNPA and bisulfite. The relationship between the bromide peak areas and the DBNPA concentrations showed a good linearity and a coefficient of determination (R(2)) of 0.9997 in the evaluated concentration range of 0-75 μmol L(-1). The detection and quantification limits for DBNPA were 0.23 and 0.75 μmol L(-1), respectively. The proposed CE method was successfully applied for the analysis of samples of tap water and cooling water spiked with DBNPA. The intra-day and inter-day (intermediary) precisions were lower than 2.8 and 6.2%, respectively. The DBNPA concentrations measured by the CE method were compared to the values obtained by a spectrophotometric method and were found to agree well.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.