Leucine Supplementation Does Not Affect Protein Turnover And Impairs The Beneficial Effects Of Endurance Training On Glucose Homeostasis In Healthy Mice.

Endurance exercise training as well as leucine supplementation modulates glucose homeostasis and protein turnover in mammals. Here, we analyze whether leucine supplementation alters the effects of endurance exercise on these parameters in healthy mice. Mice were distributed into sedentary (C) and exercise (T) groups. The exercise group performed a 12-week swimming protocol. Half of the C and T mice, designated as the CL and TL groups, were supplemented with leucine (1.5 % dissolved in the drinking water) throughout the experiment. As well known, endurance exercise training reduced body weight and the retroperitoneal fat pad, increased soleus mass, increased VO2max, decreased muscle proteolysis, and ameliorated peripheral insulin sensitivity. Leucine supplementation had no effect on any of these parameters and worsened glucose tolerance in both CL and TL mice. In the soleus muscle of the T group, AS-160(Thr-642) (AKT substrate of 160 kDa) and AMPK(Thr-172) (AMP-Activated Protein Kinase) phosphorylation was increased by exercise in both basal and insulin-stimulated conditions, but it was reduced in TL mice with insulin stimulation compared with the T group. Akt phosphorylation was not affected by exercise but was lower in the CL group compared with the other groups. Leucine supplementation increased mTOR phosphorylation at basal conditions, whereas exercise reduced it in the presence of insulin, despite no alterations in protein synthesis. In trained groups, the total FoxO3a protein content and the mRNA for the specific isoforms E2 and E3 ligases were reduced. In conclusion, leucine supplementation did not potentiate the effects of endurance training on protein turnover, and it also reduced its positive effects on glucose homeostasis.

Inhibitory Effects Of A Cured Antibacterial Bonding System On Viability And Metabolic Activity Of Oral Bacteria.

To evaluate the antimicrobial efficacy of Clearfil SE Protect (CP) and Clearfil SE Bond (CB) after curing and rinsed against five individual oral microorganisms as well as a mixture of bacterial culture prepared from the selected test organisms. Bacterial suspensions were prepared from single species of Streptococcus mutans, Streptococcus sobrinus, Streptococcus gordonii, Actinomyces viscosus and Lactobacillus lactis, as well as mixed bacterial suspensions from these organisms. Dentin bonding system discs (6 mm×2 mm) were prepared, cured, washed and placed on the bacterial suspension of single species or multispecies bacteria for 15, 30 and 60 min. MTT, Live/Dead bacterial viability (antibacterial effect), and XTT (metabolic activity) assays were used to test the two dentin system's antibacterial effect. All assays were done in triplicates and each experiment repeated at least three times. Data were submitted to ANOVA and Scheffe's f-test (5%). Greater than 40% bacteria killing was seen within 15 min, and the killing progressed with increasing time of incubation with CP discs. However, a longer (60 min) period of incubation was required by CP to achieve similar antimicrobial effect against mixed bacterial suspension. CB had no significant effect on the viability or metabolic activity of the test microorganisms when compared to the control bacterial culture. CP was significantly effective in reducing the viability and metabolic activity of the test organisms. The results demonstrated the antimicrobial efficacy of CP both on single and multispecies bacterial culture. CP may be beneficial in reducing bacterial infections in cavity preparations in clinical dentistry.

Overexpression Of Ucp1 In Tobacco Induces Mitochondrial Biogenesis And Amplifies A Broad Stress Response.

Uncoupling protein one (UCP1) is a mitochondrial inner membrane protein capable of uncoupling the electrochemical gradient from adenosine-5'-triphosphate (ATP) synthesis, dissipating energy as heat. UCP1 plays a central role in nonshivering thermogenesis in the brown adipose tissue (BAT) of hibernating animals and small rodents. A UCP1 ortholog also occurs in plants, and aside from its role in uncoupling respiration from ATP synthesis, thereby wasting energy, it plays a beneficial role in the plant response to several abiotic stresses, possibly by decreasing the production of reactive oxygen species (ROS) and regulating cellular redox homeostasis. However, the molecular mechanisms by which UCP1 is associated with stress tolerance remain unknown. Here, we report that the overexpression of UCP1 increases mitochondrial biogenesis, increases the uncoupled respiration of isolated mitochondria, and decreases cellular ATP concentration. We observed that the overexpression of UCP1 alters mitochondrial bioenergetics and modulates mitochondrial-nuclear communication, inducing the upregulation of hundreds of nuclear- and mitochondrial-encoded mitochondrial proteins. Electron microscopy analysis showed that these metabolic changes were associated with alterations in mitochondrial number, area and morphology. Surprisingly, UCP1 overexpression also induces the upregulation of hundreds of stress-responsive genes, including some involved in the antioxidant defense system, such as superoxide dismutase (SOD), glutathione peroxidase (GPX) and glutathione-S-transferase (GST). As a consequence of the increased UCP1 activity and increased expression of oxidative stress-responsive genes, the UCP1-overexpressing plants showed reduced ROS accumulation. These beneficial metabolic effects may be responsible for the better performance of UCP1-overexpressing lines in low pH, high salt, high osmolarity, low temperature, and oxidative stress conditions. Overexpression of UCP1 in the mitochondrial inner membrane induced increased uncoupling respiration, decreased ROS accumulation under abiotic stresses, and diminished cellular ATP content. These events may have triggered the expression of mitochondrial and stress-responsive genes in a coordinated manner. Because these metabolic alterations did not impair plant growth and development, UCP1 overexpression can potentially be used to create crops better adapted to abiotic stress conditions.

Cognitive And Behavioral Heterogeneity In Genetic Syndromes.

this study aimed to investigate the cognitive and behavioral profiles, as well as the psychiatric symptoms and disorders in children with three different genetic syndromes with similar sociocultural and socioeconomic backgrounds. thirty-four children aged 6 to 16 years, with Williams-Beuren syndrome (n=10), Prader-Willi syndrome (n=11), and Fragile X syndrome (n=13) from the outpatient clinics of Child Psychiatry and Medical Genetics Department were cognitively assessed through the Wechsler Intelligence Scale for Children (WISC-III). Afterwards, a full-scale intelligence quotient (IQ), verbal IQ, performance IQ, standard subtest scores, as well as frequency of psychiatric symptoms and disorders were compared among the three syndromes. significant differences were found among the syndromes concerning verbal IQ and verbal and performance subtests. Post-hoc analysis demonstrated that vocabulary and comprehension subtest scores were significantly higher in Williams-Beuren syndrome in comparison with Prader-Willi and Fragile X syndromes, and block design and object assembly scores were significantly higher in Prader-Willi syndrome compared with Williams-Beuren and Fragile X syndromes. Additionally, there were significant differences between the syndromes concerning behavioral features and psychiatric symptoms. The Prader-Willi syndrome group presented a higher frequency of hyperphagia and self-injurious behaviors. The Fragile X syndrome group showed a higher frequency of social interaction deficits; such difference nearly reached statistical significance. the three genetic syndromes exhibited distinctive cognitive, behavioral, and psychiatric patterns.

Developmental Rate Of Immatures Of Two Fly Species Of Forensic Importance: Sarcophaga (liopygia) Ruficornis And Microcerella Halli (diptera: Sarcophagidae).

Since insect species are poikilothermic organisms, they generally exhibit different growth patterns depending on the temperature at which they develop. This factor is important in forensic entomology, especially for estimating postmortem interval (PMI) when it is based on the developmental time of the insects reared in decomposing bodies. This study aimed to estimate the rates of development, viability, and survival of immatures of Sarcophaga (Liopygia) ruficornis (Fabricius 1794) and Microcerella halli (Engel 1931) (Diptera: Sarcophagidae) reared in different temperatures: 10, 15, 20, 25, 30, and 35 ± 1 °C. Bovine raw ground meat was offered as food for all experimental groups, each consisting of four replicates, in the proportion of 2 g/larva. To measure the evolution of growth, ten specimens of each group were randomly chosen and weighed every 12 h, from initial feeding larva to pupae, and then discarded. Considering the records of weight gain, survival rates, and stability of growth rates, the range of optimum temperature for the development of S. (L.) ruficornis is between 20 and 35 °C, and that of M. halli is between 20 and 25 °C. For both species, the longest times of development were in the lowest temperatures. The survival rate at extreme temperatures (10 and 35 °C) was lower in both species. Biological data such as the ones obtained in this study are of great importance to achieve a more accurate estimate of the PMI.

Taurine Supplementation Reduces Blood Pressure And Prevents Endothelial Dysfunction And Oxidative Stress In Post-weaning Protein-restricted Rats.

Taurine is a sulfur-containing amino acid that exerts protective effects on vascular function and structure in several models of cardiovascular diseases through its antioxidant and anti-inflammatory properties. Early protein malnutrition reprograms the cardiovascular system and is linked to hypertension in adulthood. This study assessed the effects of taurine supplementation in vascular alterations induced by protein restriction in post-weaning rats. Weaned male Wistar rats were fed normal- (12%, NP) or low-protein (6%, LP) diets for 90 days. Half of the NP and LP rats concomitantly received 2.5% taurine supplementation in the drinking water (NPT and LPT, respectively). LP rats showed elevated systolic, diastolic and mean arterial blood pressure versus NP rats; taurine supplementation partially prevented this increase. There was a reduced relaxation response to acetylcholine in isolated thoracic aortic rings from the LP group that was reversed by superoxide dismutase (SOD) or apocynin incubation. Protein expression of p47phox NADPH oxidase subunit was enhanced, whereas extracellular (EC)-SOD and endothelial nitric oxide synthase phosphorylation at Ser 1177 (p-eNOS) were reduced in aortas from LP rats. Furthermore, ROS production was enhanced while acetylcholine-induced NO release was reduced in aortas from the LP group. Taurine supplementation improved the relaxation response to acetylcholine and eNOS-derived NO production, increased EC-SOD and p-eNOS protein expression, as well as reduced ROS generation and p47phox expression in the aortas from LPT rats. LP rats showed an increased aortic wall/lumen ratio and taurine prevented this remodeling through a reduction in wall media thickness. Our data indicate a protective role of taurine supplementation on the high blood pressure, endothelial dysfunction and vascular remodeling induced by post-weaning protein restriction. The beneficial vascular effect of taurine was associated with restoration of vascular redox homeostasis and improvement of NO bioavailability.

Intrahippocampal Infusion Of Crotamine Isolated From Crotalus Durissus Terrificus Alters Plasma And Brain Biochemical Parameters.

Crotamine is one of the main constituents of the venom of the South American rattlesnake Crotalus durissus terrificus. Here we sought to investigate the inflammatory and toxicological effects induced by the intrahippocampal administration of crotamine isolated from Crotalus whole venom. Adult rats received an intrahippocampal infusion of crotamine or vehicle and were euthanized 24 h or 21 days after infusion. Plasma and brain tissue were collected for biochemical analysis. Complete blood count, creatinine, urea, glutamic oxaloacetic transaminase (GOT), glutamic pyruvic transaminase (GPT), creatine-kinase (CK), creatine kinase-muscle B (CK-MB) and oxidative parameters (assessed by DNA damage and micronucleus frequency in leukocytes, lipid peroxidation and protein carbonyls in plasma and brain) were quantified. Unpaired and paired t-tests were used for comparisons between saline and crotamine groups, and within groups (24 h vs. 21 days), respectively. After 24 h crotamine infusion promoted an increase of urea, GOT, GPT, CK, and platelets values (p ≤ 0.01), while red blood cells, hematocrit and leukocytes values decreased (p ≤ 0.01). Additionally, 21 days after infusion crotamine group showed increased creatinine, leukocytes, TBARS (plasma and brain), carbonyl (plasma and brain) and micronucleus compared to the saline-group (p ≤ 0.01). Our findings show that crotamine infusion alter hematological parameters and cardiac markers, as well as oxidative parameters, not only in the brain, but also in the blood, indicating a systemic pro-inflammatory and toxicological activity. A further scientific attempt in terms of preserving the beneficial activity over toxicity is required.

Toxicity Of Fungal-generated Silver Nanoparticles To Soil-inhabiting Pseudomonas Putida Kt2440, A Rhizospheric Bacterium Responsible For Plant Protection And Bioremediation.

Silver nanoparticles have attracted considerable attention due to their beneficial properties. But toxicity issues associated with them are also rising. The reports in the past suggested health hazards of silver nanoparticles at the cellular, molecular, or whole organismal level in eukaryotes. Whereas, there is also need to examine the exposure effects of silver nanoparticle to the microbes, which are beneficial to humans as well as environment. The available literature suggests the harmful effects of physically and chemically synthesised silver nanoparticles. The toxicity of biogenically synthesized nanoparticles has been less studied than physically and chemically synthesised nanoparticles. Hence, there is a greater need to study the toxic effects of biologically synthesised silver nanoparticles in general and mycosynthesized nanoparticles in particular. In the present study, attempts have been made to assess the risk associated with the exposure of mycosynthesized silver nanoparticles on a beneficial soil microbe Pseudomonas putida. KT2440. The study demonstrates mycosynthesis of silver nanoparticles and their characterisation by UV-vis spectrophotometry, FTIR, X-ray diffraction, nanosight LM20 - a particle size distribution analyzer and TEM. Silver nanoparticles obtained herein were found to exert the hazardous effect at the concentration of 0.4μg/ml, which warrants further detailed investigations concerning toxicity.

Contrasting Effects Of Land Use Intensity And Exotic Host Plants On The Specialization Of Interactions In Plant-herbivore Networks.

Human land use tends to decrease the diversity of native plant species and facilitate the invasion and establishment of exotic ones. Such changes in land use and plant community composition usually have negative impacts on the assemblages of native herbivorous insects. Highly specialized herbivores are expected to be especially sensitive to land use intensification and the presence of exotic plant species because they are neither capable of consuming alternative plant species of the native flora nor exotic plant species. Therefore, higher levels of land use intensity might reduce the proportion of highly specialized herbivores, which ultimately would lead to changes in the specialization of interactions in plant-herbivore networks. This study investigates the community-wide effects of land use intensity on the degree of specialization of 72 plant-herbivore networks, including effects mediated by the increase in the proportion of exotic plant species. Contrary to our expectation, the net effect of land use intensity on network specialization was positive. However, this positive effect of land use intensity was partially canceled by an opposite effect of the proportion of exotic plant species on network specialization. When we analyzed networks composed exclusively of endophagous herbivores separately from those composed exclusively of exophagous herbivores, we found that only endophages showed a consistent change in network specialization at higher land use levels. Altogether, these results indicate that land use intensity is an important ecological driver of network specialization, by way of reducing the local host range of herbivore guilds with highly specialized feeding habits. However, because the effect of land use intensity is offset by an opposite effect owing to the proportion of exotic host species, the net effect of land use in a given herbivore assemblage will likely depend on the extent of the replacement of native host species with exotic ones.

Digestive Peptidase Evolution In Holometabolous Insects Led To A Divergent Group Of Enzymes In Lepidoptera.

Trypsins and chymotrypsins are well-studied serine peptidases that cleave peptide bonds at the carboxyl side of basic and hydrophobic l-amino acids, respectively. These enzymes are largely responsible for the digestion of proteins. Three primary processes regulate the activity of these peptidases: secretion, precursor (zymogen) activation and substrate-binding site recognition. Here, we present a detailed phylogenetic analysis of trypsins and chymotrypsins in three orders of holometabolous insects and reveal divergent characteristics of Lepidoptera enzymes in comparison with those of Coleoptera and Diptera. In particular, trypsin subsite S1 was more hydrophilic in Lepidoptera than in Coleoptera and Diptera, whereas subsites S2-S4 were more hydrophobic, suggesting different substrate preferences. Furthermore, Lepidoptera displayed a lineage-specific trypsin group belonging only to the Noctuidae family. Evidence for facilitated trypsin auto-activation events were also observed in all the insect orders studied, with the characteristic zymogen activation motif complementary to the trypsin active site. In contrast, insect chymotrypsins did not seem to have a peculiar evolutionary history with respect to their mammal counterparts. Overall, our findings suggest that the need for fast digestion allowed holometabolous insects to evolve divergent groups of peptidases with high auto-activation rates, and highlight that the evolution of trypsins led to a most diverse group of enzymes in Lepidoptera.

Comparative Study Of Transgenic And Non-transgenic Maize (zea Mays) Flours Commercialized In Brazil, Focussing On Proteomic Analyses.

Genetically modified foods are a major concern around the world due to the lack of information concerning their safety and health effects. This work evaluates differences, at the proteomic level, between two types of crop samples: transgenic (MON810 event with the Cry1Ab gene, which confers resistance to insects) and non-transgenic maize flour commercialized in Brazil. The 2-D DIGE technique revealed 99 differentially expressed spots, which were collected in 2-D PAGE gels and identified via mass spectrometry (nESI-QTOF MS/MS). The abundance of protein differences between the transgenic and non-transgenic samples could arise from genetic modification or as a result of an environmental influence pertaining to the commercial sample. The major functional category of proteins identified was related to disease/defense and, although differences were observed between samples, no toxins or allergenic proteins were found.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.