9 resultados para Infected Buccal Cyst
em Repositório da Produção Científica e Intelectual da Unicamp
Resumo:
Primary intraosseous carcinoma of the jaws (PIOSCC) might arise from odontogenic epithelium, more commonly from a previous odontogenic cyst. The aim of this case is to illustrate that the clinician should consider that an apparent benign dentigerous cyst can suffer malignant transformation and that all material removed from a patient must be evaluated histologically. A 44-year-old man presented in a routine periapical X-ray an impacted lower left third molar with radiolucency over its crown. Ten years later, the patient complained of pain in the same region and the tooth was extracted. After one month, the patient still complained of pain and suffered a fracture of the mandible. A biopsy was performed and carcinoma was diagnosed. The patient was treated surgically with adjuvant radio- and chemotherapy and after 8 years, he is well without signs of recurrences. This report describes a central mandibular carcinoma probably developed from a previous dentigerous cyst.
Resumo:
To verify whether fluorescence in situ hybridization (FISH) of cells from the buccal epithelium could be employed to detect cryptomosaicism with a 45,X lineage in 46,XY patients. Samples of nineteen 46,XY healthy young men and five patients with disorders of sex development (DSD), four 45,X/46,XY and one 46,XY were used. FISH analysis with X and Y specific probes on interphase nuclei from blood lymphocytes and buccal epithelium were analyzed to investigate the proportion of nuclei containing only the signal of the X chromosome. The frequency of nuclei containing only the X signal in the two tissues of healthy men did not differ (p = 0.69). In all patients with DSD this frequency was significantly higher, and there was no difference between the two tissues (p = 0.38), either. Investigation of mosaicism with a 45,X cell line in patients with 46,XY DSD or sterility can be done by FISH directly using cells from the buccal epithelium.
Resumo:
In the Amazon Region, there is a virtual absence of severe malaria and few fatal cases of naturally occurring Plasmodium falciparum infections; this presents an intriguing and underexplored area of research. In addition to the rapid access of infected persons to effective treatment, one cause of this phenomenon might be the recognition of cytoadherent variant proteins on the infected red blood cell (IRBC) surface, including the var gene encoded P. falciparum erythrocyte membrane protein 1. In order to establish a link between cytoadherence, IRBC surface antibody recognition and the presence or absence of malaria symptoms, we phenotype-selected four Amazonian P. falciparum isolates and the laboratory strain 3D7 for their cytoadherence to CD36 and ICAM1 expressed on CHO cells. We then mapped the dominantly expressed var transcripts and tested whether antibodies from symptomatic or asymptomatic infections showed a differential recognition of the IRBC surface. As controls, the 3D7 lineages expressing severe disease-associated phenotypes were used. We showed that there was no profound difference between the frequency and intensity of antibody recognition of the IRBC-exposed P. falciparum proteins in symptomatic vs. asymptomatic infections. The 3D7 lineages, which expressed severe malaria-associated phenotypes, were strongly recognised by most, but not all plasmas, meaning that the recognition of these phenotypes is frequent in asymptomatic carriers, but is not necessarily a prerequisite to staying free of symptoms.
Resumo:
Reports of long-term tenofovir disoproxil fumarate (TDF) treatment in HIV-infected adolescents are limited. We present final results from the open-label (OL) TDF extension following the randomized, placebo (PBO)-controlled, double-blind phase of GS-US-104-0321 (Study 321). HIV-infected 12- to 17-year-olds treated with TDF 300 mg or PBO with an optimized background regimen (OBR) for 24-48 weeks subsequently received OL TDF plus OBR in a single arm study extension. HIV-1 RNA and safety, including bone mineral density (BMD), was assessed in all TDF recipients. Eighty-one subjects received TDF (median duration 96 weeks). No subject died or discontinued OL TDF for safety/tolerability. At week 144, proportions with HIV-1 RNA <50 copies/mL were 30.4% (7 of 23 subjects with baseline HIV-1 RNA >1000 c/mL initially randomized to TDF), 41.7% (5 of 12 subjects with HIV-1 RNA <1000 c/mL who switched PBO to TDF) and 0% (0 of 2 subjects failed randomized PBO plus OBR with HIV-1 RNA >1000 c/mL and switched PBO to TDF). Viral resistance to TDF occurred in 1 subject. At week 144, median decrease in estimated glomerular filtration rate was 38.1 mL/min/1.73 m (n = 25). Increases in median spine (+12.70%, n = 26) and total body less head BMD (+4.32%, n = 26) and height-age adjusted Z-scores (n = 21; +0.457 for spine, +0.152 for total body less head) were observed at week 144. Five of 81 subjects (6%) had persistent >4% BMD decreases from baseline. Some subjects had virologic responses to TDF plus OBR, and TDF resistance was rare. TDF was well tolerated and can be considered for treatment of HIV-infected adolescents.
Resumo:
Low bone mineral density (BMD) has been found in human immunodeficiency virus (HIV)-infected patients; however, data on associated factors remain unclear, specifically in middle-aged women. This study aims to evaluate factors associated with low BMD in HIV-positive women. In this cross-sectional study, a questionnaire was administered to 206 HIV-positive women aged 40 to 60 years who were receiving outpatient care. Clinical features, laboratory test results, and BMD were assessed. Yates and Pearson χ(2) tests and Poisson multiple regression analysis were performed. The median age of women was 47.7 years; 75% had nadir CD4 T-cell counts higher than 200, and 77.8% had viral loads below the detection limit. There was no association between low BMD at the proximal femur and lumbar spine (L1-L4) and risk factors associated with HIV infection and highly active antiretroviral therapy. Poisson multiple regression analysis showed that the only factor associated with low BMD at the proximal femur and lumbar spine was postmenopause status. Low BMD is present in more than one third of this population sample, in which most women are using highly active antiretroviral therapy and have a well-controlled disease. The main associated factor is related to estrogen deprivation. The present data support periodic BMD assessments in HIV-infected patients and highlight the need to implement comprehensive menopausal care for these women to prevent bone loss.
Resumo:
This study investigated the presence of target bacterial species and the levels of endotoxins in teeth with apical periodontitis. Levels of inflammatory mediators (interleukin [IL]-1β and tumor necrosis factor [TNF]-α) were determined after macrophage stimulation with endodontic content after different phases of endodontic therapy using different irrigants. Thirty primarily infected root canals were randomly assigned into 3 groups according to the irrigant used for root canal preparation (n = 10 per group): GI: 2.5% sodium hypochlorite, GII: 2% chlorhexidine gel, and GIII (control group): saline solution. Root canal samples were taken by using paper points before (s1) and after root canal instrumentation (s2), subsequently to 17% EDTA (s3), after 30 days of intracanal medication (Ca[OH]2 + saline solution) (s4), and before root canal obturation (s5). Polymerase chain reaction (16S recombinant DNA) and limulus amebocyte lysate assay were used for bacterial and endotoxin detection, respectively. Macrophages were stimulated with the root canal contents for IL-1β/TNF-α measurement using enzyme-linked immunosorbent assay. Porphyromonas gingivalis (17/30), Porphyromonas endodontalis (15/30), and Prevotella nigrescens (11/30) were the most prevalent bacterial species. At s1, endotoxins were detected in 100% of the root canals (median = 32.43 EU/mL). In parallel, substantial amounts of IL-1β and TNF-α were produced by endodontic content-stimulated macrophages. At s2, a significant reduction in endotoxin levels was observed in all groups, with GI presenting the greatest reduction (P < .05). After a root canal rinse with EDTA (s3), intracanal medication (s4), and before root canal obturation (s5), endotoxin levels reduced without differences between groups (P < .05). IL-1β and TNF-α release decreased proportionally to the levels of residual endotoxin (P < .05). Regardless of the use of sodium hypochlorite or CHX, the greatest endotoxin reduction occurs after chemomechanical preparation. Increasing steps of root canal therapy associated with intracanal medication enhances endotoxin reduction, leading to a progressively lower activation of proinflammatory cells such as macrophages.
Resumo:
We report four cases of surgically treated intracranial arachnoid cysts, one with cyst-peritoneal shunt and three with craniotomy and arachnoid membrane resection. Their classification and etiopathogeny are discussed, and especially the different methods of treatment comparing the drastic complications (adversities) with the favorable solutions in severe clinical cases (plasticity) treated at our institution.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
From 1992 to 1995 we studied 232 (69% male, 87% Caucasian) anti-human immunodeficiency virus (anti-HIV) positive Brazilian patients, through a questionnaire; HIV had been acquired sexually by 50%, from blood by 32%, sexually and/or from blood by 16.4% and by an unknown route by 1.7%. Intravenous drug use was reported by 29%; it was the most important risk factor for HIV transmission. The alanine aminotransferase quotient (qALT) was >1 for 40% of the patients, 93.6% had anti-hepatitis A virus antibody, 5.3% presented hepatitis B surface antigen, 44% were anti-hepatitis B core antigen positive and 53.8% were anti-hepatitis C virus (anti-HCV) positive. The anti-HCV test showed a significant association with qALT>1. Patients for whom the probable HIV transmission route was blood had a 10.8 times greater risk of being anti-HCV positive than patients infected by other routes. Among 30 patients submitted to liver biopsy, 18 presented chronic hepatitis.