13 resultados para Immunohistochemical Detection
em Repositório da Produção Científica e Intelectual da Unicamp
Resumo:
Paracoccidioidomycosis is a systemic mycosis that is endemic to certain countries in Latin America. This study aimed to describe the histological features of liver involvement in patients with paracoccidioidomycosis aged <16 years of age who were treated between 1980 and 2010, with a diagnosis that was confirmed by detection of the fungus by pathological examination. Liver tissue was obtained from one necropsy and 12 biopsies. Throughout 2007, biopsies were taken from patients with persistent jaundice or portal hypertension, after which biopsies became indicated due to elevated aminotransferase and low albumin levels. Using haematoxylin and eosin (H&E), Masson's trichrome and immunohistochemical (CK7 and CK19) staining, we noted degenerative alterations in bile duct cells and inflammatory injury to the bile ducts in 10 biopsies. Using immunohistochemistry for CK7 and CK19, we observed ductal proliferation in all 12 samples. Bile duct injuries by inflammatory cells might explain the predominant increase in canalicular enzymes; immunohistochemistry is more sensitive in demonstrating ductular reactions and might show changes that are not apparent on H&E staining.
Resumo:
Cardiac arrest during heart surgery is a common procedure and allows the surgeon to perform surgical procedures in an environment free of blood and movement. Using a model of isolated rat heart, the authors compare a new cardioplegic solution containing histidine-tryptophan-glutamate (group 2) with the histidine-tryptophan-alphacetoglutarate (group 1) routinely used by some cardiac surgeons. To assess caspase, IL-8 and KI-67 in isolated rat hearts using immunohistochemistry. 20 Wistar male rats were anesthetized and heparinized. The chest was opened, cardioctomy was performed and 40 ml/kg of the appropriate cardioplegic solution was infused. The hearts were kept for 2 hours at 4ºC in the same solution, and thereafter, placed in the Langendorff apparatus for 30 minutes with Ringer-Locke solution. Immunohistochemistry analysis of caspase, IL-8, and KI-67 were performed. The concentration of caspase was lower in group 2 and Ki-67 was higher in group 2, both P<0.05. There was no statistical difference between the values of IL-8 between the groups. Histidine-tryptophan-glutamate solution was better than histidine-tryptophan-alphacetoglutarate solution because it reduced caspase (apoptosis), increased KI-67 (cell proliferation), and showed no difference in IL-8 levels compared to group 1. This suggests that the histidine-tryptophan-glutamate solution was more efficient than the histidine-tryptophan-alphacetoglutarate for the preservation of hearts of rat cardiomyocytes.
Resumo:
Pilomatrixoma, craniopharyngioma, and calcifying cystic odontogenic tumor are the main entities presenting ghost cells as an important histological feature, in spite their quite different clinical presentation; it seems that they share a common pathway in the formation of these cells. The aim of this study is to examine and compare the characteristics of ghost and other cells that form these lesions. Forty-three cases including 21 pilomatrixomas, 14 craniopharyngiomas, and eight calcifying cystic odontogenic tumors were evaluated by immunohistochemistry for cytokeratins, CD138, β-catenin, D2-40, Glut-1, FAS, CD10 and also by scanning electron microscopy. The CKs, CD138, β-catenin, Glut-1, FAS, and CD10 were more often expressed by transitional cells of craniopharyngioma and calcifying cystic odontogenic tumor, compared with pilomatrixoma. Basaloid cells of pilomatrixoma showed strong positivity for CD138 and CD10. Differences on expression pattern were identified in transitional and basal cells, as ghost cells were negative for most antibodies used, except by low expression for cytokeratins. By scanning electron microscopy, the morphology of ghost cells were similar in their fibrillar cytoplasm, but their pattern varied from sheets in pilomatrixoma to small clusters in craniopharyngioma and calcifying cystic odontogenic tumor. Mechanisms involved in formation of ghost cells are unknown, but probably they follow different pathways as protein expression in the basal/transitional cells was not uniform in the three tumors studied.
Resumo:
Chronic telogen effluvium (CTE), a poorly understood condition, can be confused with or may be a prodrome to female pattern hair loss (FPHL). The pathogenesis of both is related to follicle cycle shortening and possibly to blood supply changes. To analyze a number of histomorphometric and immunohistochemical findings through vascular endothelial growth factor (VEGF), Ki-67, and CD31 immunostaining in scalp biopsies of 20 patients with CTE, 17 patients with mild FPHL and 9 controls. Ki-67 index and VEGF optical density were analyzed at the follicular outer sheath using ImageJ software. CD31 microvessel density was assessed by a Chalkley grid. Significant follicle miniaturization and higher density of nonanagen follicles were found in FPHL, compared with patients with CTE and controls. Ki-67+ index correlated positively with FPHL histological features. The FPHL group showed the highest VEGF optical density, followed by the CTE and control groups. No differences were found in CD31 microvessel density between the three groups. Histomorphometric results establish CTE as a distinct disorder, separate from FPHL from its outset. Its pathogenic mechanisms are also distinct. These findings support the proposed mechanism of 'immediate telogen release' for CTE, leading to cycle synchronization. For FPHL, accelerated anagen follicular mitotic rates and, thus, higher Ki-67 and VEGF values, would leave less time for differentiation, resulting in hair miniaturization.
Resumo:
In oral and oropharyngeal squamous cell carcinoma (OCSCC and OPSCC) exist an association between clinical and histopathological parameters with cell proliferation, basal lamina, connective tissue degradation and surrounding stroma markers. We evaluated these associations in Chilean patients. A convenience sample of 37 cases of OCSCC (n=16) and OPSCC (n=21) was analyzed clinically (TNM, clinical stage) and histologically (WHO grade of differentiation, pattern of tumor invasion). We assessed the expression of p53, Ki67, HOXA1, HOXB7, type IV collagen (ColIV) and carcinoma-associated fibroblast (α-SMA-positive cells). Additionally we conducted a univariate/bivariate analysis to assess the relationship of these variables with survival rates. Males were mostly affected (56.2% OCSCC, 76.2% OPSCC). Patients were mainly diagnosed at III/IV clinical stages (68.8% OCSCC, 90.5% OPSCC) with a predominantly infiltrative pattern invasion (62.9% OCSCC, 57.1% OPSCC). Significant association between regional lymph nodes (N) and clinical stage with OCSCC-HOXB7 expression (Chi-Square test P < 0.05) was observed. In OPSCC a statistically significant association exists between p53, Ki67 with gender (Chi-Square test P < 0.05). In OCSCC and OPSCC was statistically significant association between ki67 with HOXA1, HOXB7, and between these last two antigens (Pearson's Correlation test P < 0.05). Furthermore OPSCC-p53 showed significant correlation when it was compared with α-SMA (Kendall's Tau-c test P < 0.05). Only OCSCC-pattern invasion and OPSCC-primary tumor (T) pattern resulted associated with survival at the end of the follow up period (Chi-Square Likelihood Ratio, P < 0.05). Clinical, histological and immunohistochemical features are similar to seen in other countries. Cancer proliferation markers were associated strongly from each other. Our sample highlights prognostic value of T and pattern of invasion, but the conclusions may be limited and should be considered with caution (small sample). Many cases were diagnosed in the advanced stages of the disease, which suggests that the diagnosis of OCSCC and OPSCC is made late.
Resumo:
To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.
Resumo:
To determine the most adequate number and size of tissue microarray (TMA) cores for pleomorphic adenoma immunohistochemical studies. Eighty-two pleomorphic adenoma cases were distributed in 3 TMA blocks assembled in triplicate containing 1.0-, 2.0-, and 3.0-mm cores. Immunohistochemical analysis against cytokeratin 7, Ki67, p63, and CD34 were performed and subsequently evaluated with PixelCount, nuclear, and microvessel software applications. The 1.0-mm TMA presented lower results than 2.0- and 3.0-mm TMAs versus conventional whole section slides. Possibly because of an increased amount of stromal tissue, 3.0-mm cores presented a higher microvessel density. Comparing the results obtained with one, two, and three 2.0-mm cores, there was no difference between triplicate or duplicate TMAs and a single-core TMA. Considering the possible loss of cylinders during immunohistochemical reactions, 2.0-mm TMAs in duplicate are a more reliable approach for pleomorphic adenoma immunohistochemical study.
Resumo:
A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.
Resumo:
Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.
Resumo:
The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).
Resumo:
Ameloblastic fibro-odontoma (AFO) is a slow-growing, expansive, benign odontogenic tumor, composed of ameloblastic epithelium embedded in an ectomesenchymal stroma resembling dental papilla, containing hard dental tissue in variable degrees of maturation, including enamel, dentin, and sometimes cementum. AFO typically affects the posterior mandible, causing bony expansion. We report a case of pigmented AFO in a 5-year-old boy, comprising clinical and histological features illustrated by immunohistochemistry using a large panel of antibodies, polarized light microscopy and scanning electron microscopy.
Resumo:
A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.