Molecular And Biochemical Characterization Of Caffeine Synthase And Purine Alkaloid Concentration In Guarana Fruit.

Guarana seeds have the highest caffeine concentration among plants accumulating purine alkaloids, but in contrast with coffee and tea, practically nothing is known about caffeine metabolism in this Amazonian plant. In this study, the levels of purine alkaloids in tissues of five guarana cultivars were determined. Theobromine was the main alkaloid that accumulated in leaves, stems, inflorescences and pericarps of fruit, while caffeine accumulated in the seeds and reached levels from 3.3% to 5.8%. In all tissues analysed, the alkaloid concentration, whether theobromine or caffeine, was higher in young/immature tissues, then decreasing with plant development/maturation. Caffeine synthase activity was highest in seeds of immature fruit. A nucleotide sequence (PcCS) was assembled with sequences retrieved from the EST database REALGENE using sequences of caffeine synthase from coffee and tea, whose expression was also highest in seeds from immature fruit. The PcCS has 1083bp and the protein sequence has greater similarity and identity with the caffeine synthase from cocoa (BTS1) and tea (TCS1). A recombinant PcCS allowed functional characterization of the enzyme as a bifunctional CS, able to catalyse the methylation of 7-methylxanthine to theobromine (3,7-dimethylxanthine), and theobromine to caffeine (1,3,7-trimethylxanthine), respectively. Among several substrates tested, PcCS showed higher affinity for theobromine, differing from all other caffeine synthases described so far, which have higher affinity for paraxanthine. When compared to previous knowledge on the protein structure of coffee caffeine synthase, the unique substrate affinity of PcCS is probably explained by the amino acid residues found in the active site of the predicted protein.

Genetic Breeding And Diversity Of The Genus Passiflora: Progress And Perspectives In Molecular And Genetic Studies.

Despite the ecological and economic importance of passion fruit (Passiflora spp.), molecular markers have only recently been utilized in genetic studies of this genus. In addition, both basic genetic researches related to population studies and pre-breeding programs of passion fruit remain scarce for most Passiflora species. Considering the number of Passiflora species and the increasing use of these species as a resource for ornamental, medicinal, and food purposes, the aims of this review are the following: (i) to present the current condition of the passion fruit crop; (ii) to quantify the applications and effects of using molecular markers in studies of Passiflora; (iii) to present the contributions of genetic engineering for passion fruit culture; and (iv) to discuss the progress and perspectives of this research. Thus, the present review aims to summarize and discuss the relationship between historical and current progress on the culture, breeding, and molecular genetics of passion fruit.

Preparation Of An Agar-silver Nanoparticles (a-agnp) Film For Increasing The Shelf-life Of Fruits.

Preparation of protective coating possessing antimicrobial properties is present day need as they increase the shelf life of fruits and vegetables. In the present study, preparation of agar-silver nanoparticle film for increasing the shelf life of fruits is reported. Silver nanoparticles (Ag-NPs) biosynthesised using an extract of Ocimum sanctum leaves, were mixed with agar-agar to prepare an agar-silver nanoparticles (A-AgNp) film. This film was surface-coated over the fruits, Citrus aurantifolium (Thornless lime) and Pyrus malus (Apple), and evaluated for the determination of antimicrobial activity of A-AgNp films using disc diffusion method, weight loss and shelf life of fruits. This study demonstrates that these A-AgNp films possess antimicrobial activity and also increase the shelf life of fruits.

Nitric Oxide-releasing Poly(vinyl Alcohol) Film For Increasing Dermal Vasodilation.

Pathological conditions associated with the impairment of nitric oxide (NO) production in the vasculature, such as Raynaud's syndrome and diabetic angiopathy, have stimulated the development of new biomaterials capable of delivering NO topically. With this purpose, we modified poly(vinyl-alcohol) (PVA) by chemically crosslinking it via esterification with mercaptosuccinic acid. This reaction allowed the casting of sulfhydrylated PVA (PVA-SH) films. Differential scanning calorimetry and X-ray diffractometry showed that the crosslinking reaction completely suppressed the crystallization of PVA, leading to a non-porous film with a homogeneous distribution of -SH groups. The remaining free hydroxyl groups in the PVA-SH network conferred partial hydrophylicity to the material, which was responsible for a swelling degree of ca. 110%. The PVA-SH films were subjected to an S-nitrosation reaction of the -SH groups, yielding a PVA containing S-nitrosothiol groups (PVA-SNO). Amperometric and chemiluminescence measurements showed that the PVA-SNO films were capable of releasing NO spontaneously after immersion in physiological medium. Laser Doppler-flowmetry, used to assess the blood flow in the dermal microcirculation, showed that the topical application of hydrated PVA-SNO films on the health skin led to a dose- and time-dependent increase of more than 5-fold in the dermal baseline blood flow in less than 10min, with a prolonged action of more than 4h during continuous application. These results show that PVA-SNO films might emerge as a new material with potential for the topical treatment of microvascular skin disorders.

Molecular Genetic Variability Of Commercial And Wild Accessions Of Passion Fruit (passiflora Spp.) Targeting Ex Situ Conservation And Breeding.

Passiflora species are distributed throughout Latin America, and Brazil and Colombia serve as the centers of diversity for this genus. We performed cross-species amplification to evaluate 109 microsatellite loci in 14 Passiflora species and estimated the diversity and genetic structure of Passiflora cincinnata, Passiflora setaceae and Passiflora edulis. A total of 127 accessions, including 85 accessions of P. edulis, a commercial species, and 42 accessions of 13 wild species, were examined. The cross-species amplification was effective for obtaining microsatellite loci (average cross-amplification of 70%). The average number of alleles per locus (five) was relatively low, and the average diversity ranged from 0.52 in P. cincinnata to 0.32 in P. setacea. The Bayesian analyses indicated that the P. cincinnata and P. setacea accessions were distributed into two groups, and the P. edulis accessions were distributed into five groups. Private alleles were identified, and suggestions for core collections are presented. Further collections are necessary, and the information generated may be useful for breeding and conservation.

(-)-tarchonanthuslactone Exerts A Blood Glucose-increasing Effect In Experimental Type 2 Diabetes Mellitus.

A number of studies have proposed an anti-diabetic effect for tarchonanthuslactone based on its structural similarity with caffeic acid, a compound known for its blood glucose-reducing properties. However, the actual effect of tarchonanthuslactone on blood glucose level has never been tested. Here, we report that, in opposition to the common sense, tarchonanthuslactone has a glucose-increasing effect in a mouse model of obesity and type 2 diabetes mellitus. The effect is acute and non-cumulative and is present only in diabetic mice. In lean, glucose-tolerant mice, despite a slight increase in blood glucose levels, the effect was not significant.

Modeling The Effects Of Temperature And Ph On The Resistance Of Alicyclobacillus Acidoterrestris In Conventional Heat-treated Fruit Beverages Through A Meta-analysis Approach.

In this work, all publicly-accessible published findings on Alicyclobacillus acidoterrestris heat resistance in fruit beverages as affected by temperature and pH were compiled. Then, study characteristics (protocols, fruit and variety, °Brix, pH, temperature, heating medium, culture medium, inactivation method, strains, etc.) were extracted from the primary studies, and some of them incorporated to a meta-analysis mixed-effects linear model based on the basic Bigelow equation describing the heat resistance parameters of this bacterium. The model estimated mean D* values (time needed for one log reduction at a temperature of 95 °C and a pH of 3.5) of Alicyclobacillus in beverages of different fruits, two different concentration types, with and without bacteriocins, and with and without clarification. The zT (temperature change needed to cause one log reduction in D-values) estimated by the meta-analysis model were compared to those ('observed' zT values) reported in the primary studies, and in all cases they were within the confidence intervals of the model. The model was capable of predicting the heat resistance parameters of Alicyclobacillus in fruit beverages beyond the types available in the meta-analytical data. It is expected that the compilation of the thermal resistance of Alicyclobacillus in fruit beverages, carried out in this study, will be of utility to food quality managers in the determination or validation of the lethality of their current heat treatment processes.

Otimização da eficiência de limpeza em equipamento de beneficiamento de tomate de mesa

The post-harvesting cleaning process in fresh market tomatoes production is essential to the consumer acceptance, since the degree of dirtiness of the fruits is directly related to its quality. However, the washing stage of the cleaning process of commercial packinghouse demands an excessive water volume, bringing serious environmental concerns. The objective of this work was to compare the cleaning efficiency in two cleaning systems through the evaluation of different operational conditions of the cleaning process, related with the brush rotation, water flow and fruit standing time under the system. It was compared the conventional system utilized in commercial equipment with a system using commercial sprays. The results showed that the cleaning efficiency was not directly related to the water volume used, but to the water pressure, standing time and brushes rotation. Therefore, the use of commercial sprays can bring benefits to the cleaning efficiency, increasing it up to 13%, and to the environmental, decreasing water consumption.

Malpighiaceae: correlations between habit, fruit type and basic chromosome number

The family Malpighiaceae presents species with different habits, fruit types and cytological characters. Climbers are considered the most derived habit, followed, respectively, by the shrubby and arboreal ones. The present study examines the relationship between basic chromosome numbers and the derivation of climbing habit and fruit types in Malpighiaceae. A comparison of all the chromosome number reports for Malpighiaceae showed a predominance of chromosome numbers based on x=5 or 10 in the genera of sub-family Malpighioideae, mainly represented by climbers with winged fruits, whereas non-climbing species with non-winged fruits, which predominate in sub-family Byrsonimoideae, had counts based on x=6, which is considered the less derived basic number for the family. Based on such data, confirmed by statistic assays, and on the monophyletic origin of this family, we admit the hypothesis that morphological derivation of habit and fruit is correlated with chromosome basic number variation in the family Malpighiaceae.

Desidratação osmótica de abacaxi aplicada à tecnologia de métodos combinados

The aim of this research was to optimize osmotic dehydration of pineapple, according to two criteria: maximize water loss and minimize solid gain. The process was made as an application to Combined Methods Technology, in which three preservation factors were combined: water activity, pH and chemical preservatives, all being applied at low levels, in order to get a product resembling non-processed fruit. The experiment was divided into three treatments, being: non-coated pineapple pieces (A), pieces coated with alginate (B) and coated with low-methoxyl pectin (C). Process involved the following main steps: enzymatic inactivation of fruit pieces; in treatments B and C, incorporation of their respective coatings; and osmotic dehydration, in sucrose syrup containing potassium sorbate and citric acid. Optimum conditions, determined from Response Surface Methodology, were the following: dehydration of fruit pieces coated by alginate, at 42-47° C, in sucrose syrup at 66-69° Brix, for 220 to 270 minutes. Results indicated that both coatings significantly affected the mass transfers of the process, reducing solid incorporation and increasing water loss; therefore, increasing weight loss and performance ratio (water loss: solid incorporation) took place. Water activity was not significantly affected by the coatings. The product obtained under optimum conditions was submitted to sensorial evaluation, and presented a good general acceptance. Moulds and yeasts countings indicated good microbiological stability of the product for at least 60 days at 30ºC.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.