Microbial Evaluation Of Traumatized Teeth Treated With Triple Antibiotic Paste Or Calcium Hydroxide With 2% Chlorhexidine Gel In Pulp Revascularization.

Revascularization outcome depends on microbial elimination because apical repair will not happen in the presence of infected tissues. This study evaluated the microbial composition of traumatized immature teeth and assessed their reduction during different stages of the revascularization procedures performed with 2 intracanal medicaments. Fifteen patients (7-17 years old) with immature teeth were submitted to the revascularization procedures; they were divided into 2 groups according to the intracanal medicament used: TAP group (n = 7), medicated with a triple antibiotic paste, and CHP group (n = 8), dressed with calcium hydroxide + 2% chlorhexidine gel. Samples were taken before any treatment (S1), after irrigation with 6% NaOCl (S2), after irrigation with 2% chlorhexidine (S3), after intracanal dressing (S4), and after 17% EDTA irrigation (S5). Cultivable bacteria recovered from the 5 stages were counted and identified by means of polymerase chain reaction assay (16S rRNA). Both groups had colony-forming unit counts significantly reduced after S2 (P < .05); however, no significant difference was found between the irrigants (S2 and S3, P = .99). No difference in bacteria counts was found between the intracanal medicaments used (P = .95). The most prevalent bacteria detected were Actinomyces naeslundii (66.67%), followed by Porphyromonas endodontalis, Parvimonas micra, and Fusobacterium nucleatum, which were detected in 33.34% of the root canals. An average of 2.13 species per canal was found, and no statistical correlation was observed between bacterial species and clinical/radiographic features. The microbial profile of infected immature teeth is similar to that of primarily infected permanent teeth. The greatest bacterial reduction was promoted by the irrigation solutions. The revascularization protocols that used the tested intracanal medicaments were efficient in reducing viable bacteria in necrotic immature teeth.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Molecular And Biochemical Characterization Of Caffeine Synthase And Purine Alkaloid Concentration In Guarana Fruit.

Guarana seeds have the highest caffeine concentration among plants accumulating purine alkaloids, but in contrast with coffee and tea, practically nothing is known about caffeine metabolism in this Amazonian plant. In this study, the levels of purine alkaloids in tissues of five guarana cultivars were determined. Theobromine was the main alkaloid that accumulated in leaves, stems, inflorescences and pericarps of fruit, while caffeine accumulated in the seeds and reached levels from 3.3% to 5.8%. In all tissues analysed, the alkaloid concentration, whether theobromine or caffeine, was higher in young/immature tissues, then decreasing with plant development/maturation. Caffeine synthase activity was highest in seeds of immature fruit. A nucleotide sequence (PcCS) was assembled with sequences retrieved from the EST database REALGENE using sequences of caffeine synthase from coffee and tea, whose expression was also highest in seeds from immature fruit. The PcCS has 1083bp and the protein sequence has greater similarity and identity with the caffeine synthase from cocoa (BTS1) and tea (TCS1). A recombinant PcCS allowed functional characterization of the enzyme as a bifunctional CS, able to catalyse the methylation of 7-methylxanthine to theobromine (3,7-dimethylxanthine), and theobromine to caffeine (1,3,7-trimethylxanthine), respectively. Among several substrates tested, PcCS showed higher affinity for theobromine, differing from all other caffeine synthases described so far, which have higher affinity for paraxanthine. When compared to previous knowledge on the protein structure of coffee caffeine synthase, the unique substrate affinity of PcCS is probably explained by the amino acid residues found in the active site of the predicted protein.

Efficacy Of Ethylene-diamine-tetra-acetic Acid Associated With Chlorhexidine On Intracanal Medication Removal: A Scanning Electron Microscopy Study.

The aim of this study was to evaluate the effectiveness of 17% ethylene-diamine-tetra-acetic acid (EDTA) used alone or associated with 2% chlorhexidine gel (CHX) on intracanal medications (ICM) removal. Sixty single-rooted human teeth with fully formed apex were selected. The cervical and middle thirds of each canal were prepared with Gates Glidden drills and rotary files. The apical third was shaped with hand files. The specimens were randomly divided into two groups depending on the ICM used after instrumentation: calcium hydroxide Ca(OH)(2) +CHX or Ca(OH)(2) +sterile saline (SS). After seven days, each group was divided into subgroups according to the protocol used for ICM removal: instrumentation and irrigation either with EDTA, CHX+EDTA, or SS (control groups). All specimens were sectioned and processed for observation of the apical thirds by using scanning electron microscopy. Two calibrated evaluators attributed scores to each specimen. The differences between the protocols for ICM removal were analyzed with Kruskal-Wallis and Mann-Whitney U tests. Friedman and Wilcoxon signed rank tests were used for comparison between the score of debris obtained in each root canal third. Remains of Ca(OH)(2) were found in all specimens independently of the protocol and ICM used (P > 0.05). Seventeen percent EDTA showed the best results in removing ICM when used alone (P < 0.05), particularly in those associated with CHX. It was concluded that the chelating agent 17% EDTA significantly improved the removal of ICM when used alone. Furthermore, the type of the vehicle associated with Ca(OH)(2) also plays a role in the ICM removal.

A Microleakage Study Of Gutta-percha/ah Plus And Resilon/real Self-etch Systems After Different Irrigation Protocols.

The development and maintenance of the sealing of the root canal system is the key to the success of root canal treatment. The resin-based adhesive material has the potential to reduce the microleakage of the root canal because of its adhesive properties and penetration into dentinal walls. Moreover, the irrigation protocols may have an influence on the adhesiveness of resin-based sealers to root dentin. The objective of the present study was to evaluate the effect of different irrigant protocols on coronal bacterial microleakage of gutta-percha/AH Plus and Resilon/Real Seal Self-etch systems. One hundred ninety pre-molars were used. The teeth were divided into 18 experimental groups according to the irrigation protocols and filling materials used. The protocols used were: distilled water; sodium hypochlorite (NaOCl)+eDTA; NaOCl+H3PO4; NaOCl+eDTA+chlorhexidine (CHX); NaOCl+H3PO4+CHX; CHX+eDTA; CHX+ H3PO4; CHX+eDTA+CHX and CHX+H3PO4+CHX. Gutta-percha/AH Plus or Resilon/Real Seal Se were used as root-filling materials. The coronal microleakage was evaluated for 90 days against Enterococcus faecalis. Data were statistically analyzed using Kaplan-Meier survival test, Kruskal-Wallis and Mann-Whitney tests. No significant difference was verified in the groups using chlorhexidine or sodium hypochlorite during the chemo-mechanical preparation followed by eDTA or phosphoric acid for smear layer removal. The same results were found for filling materials. However, the statistical analyses revealed that a final flush with 2% chlorhexidine reduced significantly the coronal microleakage. A final flush with 2% chlorhexidine after smear layer removal reduces coronal microleakage of teeth filled with gutta-percha/AH Plus or Resilon/Real Seal SE.

Last Instar Larvae And Pupae Of Ourocnemis Archytas And Anteros Formosus (lepidoptera: Riodinidae), With A Summary Of Known Host Plants For The Tribe Helicopini.

Last instar larvae and pupae of Ourocnemis archytas (Lepidoptera: Riodinidae) are described for the first time and compared with those of Anteros formosus, which are also described in detail. Last instars of both species present body covered with long white plumose setae, a row of orange balloon setae on the prothoracic shield, and clusters of perforated cupola organs (PCOs) near the spiracles; differences are the black cephalic capsule, the placement and format of balloon setae cluster, and the presence of enlarged black tips on some plumose setae. Pupae of O. archytas resemble that of Anteros, covered with the last instar setae and with no balloon setae. Characteristics of the immature stages of these two genera could be useful to establish the still unresolved relationship between them. A summary of the host plants of Helicopini is presented, showing a polyphagous pattern for Anteros, recorded in 21 host plant families, which contrasts with the specialized diet observed in Helicopis and Sarota. 

Evaluation Of The Effect Of Different Methods Of Microabrasion And Polishing On Surface Roughness Of Dental Enamel.

The microabrasion technique of enamel consists of selectively abrading the discolored areas or causing superficial structural changes in a selective way. In microabrasion technique, abrasive products associated with acids are used, and the evaluation of enamel roughness after this treatment, as well as surface polishing, is necessary. This in-vitro study evaluated the enamel roughness after microabrasion, followed by different polishing techniques. Roughness analyses were performed before microabrasion (L1), after microabrasion (L2), and after polishing (L3).Thus, 60 bovine incisive teeth divided into two groups were selected (n=30): G1- 37% phosphoric acid (37%) (Dentsply) and pumice; G2- hydrochloric acid (6.6%) associated with silicon carbide (Opalustre - Ultradent). Thereafter, the groups were divided into three sub-groups (n=10), according to the system of polishing: A - Fine and superfine granulation aluminum oxide discs (SofLex 3M); B - Diamond Paste (FGM) associated with felt discs (FGM); C - Silicone tips (Enhance - Dentsply). A PROC MIXED procedure was applied after data exploratory analysis, as well as the Tukey-Kramer test (5%). No statistical differences were found between G1 and G2 groups. L2 differed statistically from L1 and showed superior amounts of roughness. Differences in the amounts of post-polishing roughness for specific groups (1A, 2B, and 1C) arose, which demonstrated less roughness in L3 and differed statistically from L2 in the polishing system. All products increased enamel roughness, and the effectiveness of the polishing systems was dependent upon the abrasive used.

[do Elderly Individuals With A Cognitive Handicap Have Worse Oral Health?].

A comparison of the oral health of elderly people with and without a cognitive handicap was assessed. The cognitive condition, the indices of decayed, missing, filled teeth (DMFT), decayed, filled roots (DFR), the need for dental treatment, the presence of plaque (P), calculus (C), the community periodontal index (CPI), the rate of periodontal attachment loss (PAL), edentulism, prosthetic use and the need for prosthetics were evaluated in a complex probabilistic sample by conglomerates of the elderly (65-74 years). PASW(r) 17.0 was used for the statistical analyses with correction for the design effect, applying the Mann Whitney and chi-square test with 95% reliability. A total of 736 elderly individuals were interviewed and examined. Those with cognitive impairment had higher average DMFT, DFR and lower average healthy sextant CPI, a lower prevalence of sextants without plaque/calculus, use of prosthetics and higher prevalence of edentulism and need for prosthetics. Elderly individuals with a cognitive handicap had poorer oral health.

Micromorphology Of The Dental Pulp Is Highly Preserved In Cancer Patients Who Underwent Head And Neck Radiotherapy.

Teeth are often included in the radiation field during head and neck radiotherapy, and recent clinical evidence suggests that dental pulp is negatively affected by the direct effects of radiation, leading to impaired sensitivity of the dental pulp. Therefore, this study aimed to investigate the direct effects of radiation on the microvasculature, innervation, and extracellular matrix of the dental pulp of patients who have undergone head and neck radiotherapy. Twenty-three samples of dental pulp from patients who finished head and neck radiotherapy were analyzed. Samples were histologically processed and stained with hematoxylin-eosin for morphologic evaluation of the microvasculature, innervation, and extracellular matrix. Subsequently, immunohistochemical analysis of proteins related to vascularization (CD34 and smooth muscle actin), innervation (S-100, NCAM/CD56, and neurofilament), and extracellular matrix (vimentin) of the dental pulp was performed. The morphologic study identified preservation of the microvasculature, nerve bundles, and components of the extracellular matrix in all studied samples. The immunohistochemical analysis confirmed the morphologic findings and showed a normal pattern of expression for the studied proteins in all samples. Direct effects of radiotherapy are not able to generate morphologic changes in the microvasculature, innervation, and extracellular matrix components of the dental pulp in head and neck cancer patients.

Two-component System Vicrk Regulates Functions Associated With Establishment Of Streptococcus Sanguinis In Biofilms.

Streptococcus sanguinis is a commensal pioneer colonizer of teeth and an opportunistic pathogen of infectious endocarditis. The establishment of S. sanguinis in host sites likely requires dynamic fitting of the cell wall in response to local stimuli. In this study, we investigated the two-component system (TCS) VicRK in S. sanguinis (VicRKSs), which regulates genes of cell wall biogenesis, biofilm formation, and virulence in opportunistic pathogens. A vicK knockout mutant obtained from strain SK36 (SKvic) showed slight reductions in aerobic growth and resistance to oxidative stress but an impaired ability to form biofilms, a phenotype restored in the complemented mutant. The biofilm-defective phenotype was associated with reduced amounts of extracellular DNA during aerobic growth, with reduced production of H2O2, a metabolic product associated with DNA release, and with inhibitory capacity of S. sanguinis competitor species. No changes in autolysis or cell surface hydrophobicity were detected in SKvic. Reverse transcription-quantitative PCR (RT-qPCR), electrophoretic mobility shift assays (EMSA), and promoter sequence analyses revealed that VicR directly regulates genes encoding murein hydrolases (SSA_0094, cwdP, and gbpB) and spxB, which encodes pyruvate oxidase for H2O2 production. Genes previously associated with spxB expression (spxR, ccpA, ackA, and tpK) were not transcriptionally affected in SKvic. RT-qPCR analyses of S. sanguinis biofilm cells further showed upregulation of VicRK targets (spxB, gbpB, and SSA_0094) and other genes for biofilm formation (gtfP and comE) compared to expression in planktonic cells. This study provides evidence that VicRKSs regulates functions crucial for S. sanguinis establishment in biofilms and identifies novel VicRK targets potentially involved in hydrolytic activities of the cell wall required for these functions.

Direct Adhesive Pin-retained Restorations For Severely Worn Dentition Treatment: A 1.5-year Follow-up Report.

Excessive occlusal surface wear can result in occlusal disharmony, functional and esthetic impairment. As a therapeutic approach, conventional single crowns have been proposed, but this kind of treatment is complex, highly invasive and expensive. This case report describes the clinical outcomes of an alternative minimally invasive treatment based on direct adhesive-pin retained restorations. A 64-year-old woman with severely worn dentition, eating problems related to missing teeth and generalized tooth hypersensitivity was referred for treatment. Proper treatment planning based on the diagnostic wax-up simulation was used to guide the reconstruction of maxillary anterior teeth with direct composite resin over self-threading dentin pins. As the mandibular remaining teeth were extremely worn, a tooth-supported overdenture was installed. A stabilization splint was also used to protect the restorations. This treatment was a less expensive alternative to full-mouth rehabilitation with positive esthetic and functional outcomes after 1.5 years of follow-up.

Effect Of Composite Containing An Iodonium Salt On The Bond Strength Of Brackets To Bovine Enamel.

This study investigated the effect of the incorporation of an iodonium salt in experimental composites, on the bond strength of metallic brackets bonded to bovine teeth. Two hundred and seventy bovine teeth were embedded in self-curing acrylic resin and divided into 18 groups (n=15), according to the experimental composite with an iodonium salt at molar concentrations 0 (control), 0.5, or 1%; the light-activation times (8, 20 and 40 s); and the storage times (10 min or 24 h). Metallic brackets were fixed on the tooth surface using experimental composites. Photoactivation was performed with a quartz-tungsten-halogen light-curing unit curing unit for 8, 20 and 40 s. The specimens were stored in distilled water at 37 °C for 10 min or 24 h and submitted to bond strength test at 0.5 mm/min. The data were subjected to three-way ANOVA and Tukey's test (α=0.05). The Adhesive Remnant Index (ARI) was used to classify the failure modes. The shear bond strengths (MPa) at 10 min for light-activation times of 8, 20 and 40 s were: G1 - 4.6, 6.9 and 7.1; G2 - 8.1, 9.2 and 9.9; G3 - 9.1, 10.4 and 10.7; and at 24 h were: G1 - 10.9, 11.1 and 11.7; G2 - 11.8, 12.7 and 14.2; G3 - 12.1, 14.4 and 15.8. There was a predominance of ARI score 3 for groups with 10 min storage time, and ARI score 2 for groups with 24 h storage time. In conclusion, the addition of iodonium salt (C05 and C1) to the experimental composite may increase the bond strength of brackets to bovine enamel using reduced light exposure times.

Radiotherapy Does Not Impair Dentin Adhesive Properties In Head And Neck Cancer Patients.

This study evaluated the influence of radiotherapy on the dentin bond strength of teeth extracted from patients who had undergone head and neck radiotherapy. A total of 36 samples were divided into two experimental groups: group I (control group, n = 18) and group II (in vivo irradiated group, n = 18). Groups I and II were further separated into three subgroups (six specimens per subgroup), which were further assigned to the three adhesive system protocols employed: Single Bond 2 (SB) (3M ESPE), Easy Bond (EB) (3M ESPE) and Clearfil SE Bond (CSE) (Kuraray). The adhesive systems were applied to the prepared surface according to the manufacturers' instructions and restored using composite resin (Filtek Supreme, 3M ESPE). After 24 h in deionised water (37(o)C), teeth were horizontally and vertically cut to obtain beam specimens with a cross-section area of 0.8 ± 1.0 mm(2). Specimens were tested in tension using a universal testing machine at a cross-speed of 0.5 mm/min. Fracture patterns were observed under SEM. Data was analysed by two-way analysis of variance (p ≤ 0.05). No statistically significant difference was found between the irradiated (R/SB = 44.66 ± 10.12 MPa; R/EB = 41.48 ± 12.71 MPa; and R/CSE = 46.01 ± 6.98 MPa) and control group (C/SB = 39.12 ± 9.51 MPa; C/EB = 42.40 ± 6.66 MPa; and C/CSE = 36.58 ± 7.06 MPa) for any of the adhesive systems. All groups presented a predominance of mixed fracture modes. Head and neck radiotherapy did not affect dentin bond strength for the adhesive materials tested in this study.

Dentin Bond Strength Of A Fluoride-releasing Adhesive System Submitted To Ph-cycling.

To evaluate the microtensile bond strength (µTBS) of a fluoride-containing adhesive system submitted to a pH-cycling and storage time regimen for primary outcomes. As secondary outcomes the fluoride released amount was evaluated. Twelve dentin surfaces from sound third molar were divided into 2 groups according to adhesive systems: Clearfil SE Protect (PB) and Clearfil SE Bond (SE). Sticks obtained (1.0 mm2) from teeth were randomly divided into 3 subgroups according to storage regimen model: immediate (24h); 5-month deionized water (W); and pH-cycling model (C). All sticks were tested for µTBS in a universal testing machine. Fluoride concentration was obtained from 1-4 days and 30-day in W and 1-4 days in demineralization (DE)/remineralization (RE) solutions from C, using a fluoride-specific electrode. µTBS and fluoride released data were, respectively, submitted to ANOVA in a split plot design and Tukey, and Friedman' tests (a=0.05). There was no significant interaction between adhesive system and storage regimen for µTBS. W showed the lowest µTBS values. There was no significant difference between 24 h and C models for µTBS. There was no significant difference between adhesive systems. Failure mode was predominantly cohesive within composite for the 24 h and W, for the C group it was mixed for SE and cohesive within composite for PB adhesive system. Fluoride concentrations in the DE/RE solutions were less than 0.03125 ppm and not detected in W. In conclusion, the fluoride-containing adhesive system performed similarly to the regular one. Hydrolytic degradation is the main problem with both adhesive systems, regardless of fluoride contents.

Recolonization Of Mutans Streptococci After Application Of Chlorhexidine Gel.

Streptococcus mutans is specifically suppressed by intensive treatment with chlorhexidine gel, but the time for recolonization and the effect on other oral bacteria are not totally clear. In this study, recolonization of mutans streptococci was evaluated in nine healthy adult volunteers, who were highly colonized with this microorganism. Stimulated saliva was collected before (baseline) and at 1, 7, 14, 21 and 28 days after application of 1% chlorhexidine gel on volunteers' teeth for two consecutive days. On each day, the gel was applied using disposable trays for 3 x 5 min with intervals of 5 min between each application. Saliva was plated on blood agar to determine total microorganisms (TM); on mitis salivarius agar to determine total streptococci (TS) and on mitis salivarius agar plus bacitracin to determine mutans streptococci (MS). Chlorhexidine was capable of reducing the counts of MS and the proportion of MS with regard to total microorganisms (%MS/TM) (p<0.05), but these values did not differ statistically from baseline (p>0.05) after 14 days for MS and 21 days for %MS/TM. The counts of TM and TS and the proportion of MS to total streptococci did not differ statistically from baseline (p>0.05) after chlorhexidine treatment. The results suggest that the effect of chlorhexidine gel treatment on suppression of mutans streptococci is limited to less than a month in highly colonized individuals.