Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

High-resolution Transcript Profiling Of The Atypical Biotrophic Interaction Between Theobroma Cacao And The Fungal Pathogen Moniliophthora Perniciosa.

Witches' broom disease (WBD), caused by the hemibiotrophic fungus Moniliophthora perniciosa, is one of the most devastating diseases of Theobroma cacao, the chocolate tree. In contrast to other hemibiotrophic interactions, the WBD biotrophic stage lasts for months and is responsible for the most distinctive symptoms of the disease, which comprise drastic morphological changes in the infected shoots. Here, we used the dual RNA-seq approach to simultaneously assess the transcriptomes of cacao and M. perniciosa during their peculiar biotrophic interaction. Infection with M. perniciosa triggers massive metabolic reprogramming in the diseased tissues. Although apparently vigorous, the infected shoots are energetically expensive structures characterized by the induction of ineffective defense responses and by a clear carbon deprivation signature. Remarkably, the infection culminates in the establishment of a senescence process in the host, which signals the end of the WBD biotrophic stage. We analyzed the pathogen's transcriptome in unprecedented detail and thereby characterized the fungal nutritional and infection strategies during WBD and identified putative virulence effectors. Interestingly, M. perniciosa biotrophic mycelia develop as long-term parasites that orchestrate changes in plant metabolism to increase the availability of soluble nutrients before plant death. Collectively, our results provide unique insight into an intriguing tropical disease and advance our understanding of the development of (hemi)biotrophic plant-pathogen interactions.

Partitioning The Net Effect Of Host Diversity On An Emerging Amphibian Pathogen.

The 'dilution effect' (DE) hypothesis predicts that diverse host communities will show reduced disease. The underlying causes of pathogen dilution are complex, because they involve non-additive (driven by host interactions and differential habitat use) and additive (controlled by host species composition) mechanisms. Here, we used measures of complementarity and selection traditionally employed in the field of biodiversity-ecosystem function (BEF) to quantify the net effect of host diversity on disease dynamics of the amphibian-killing fungus Batrachochytrium dendrobatidis (Bd). Complementarity occurs when average infection load in diverse host assemblages departs from that of each component species in uniform populations. Selection measures the disproportionate impact of a particular species in diverse assemblages compared with its performance in uniform populations, and therefore has strong additive and non-additive properties. We experimentally infected tropical amphibian species of varying life histories, in single- and multi-host treatments, and measured individual Bd infection loads. Host diversity reduced Bd infection in amphibians through a mechanism analogous to complementarity (sensu BEF), potentially by reducing shared habitat use and transmission among hosts. Additionally, the selection component indicated that one particular terrestrial species showed reduced infection loads in diverse assemblages at the expense of neighbouring aquatic hosts becoming heavily infected. By partitioning components of diversity, our findings underscore the importance of additive and non-additive mechanisms underlying the DE.

Thermodynamic Study Of The Micellization Of Zwitterionic Surfactants And Their Interaction With Polymers In Water By Isothermal Titration Calorimetry.

The micellization of a homologous series of zwitterionic surfactants, a group of sulfobetaines, was studied using isothermal titration calorimetry (ITC) in the temperature range from 15 to 65 °C. The increase in both temperature and the alkyl chain length leads to more negative values of ΔGmic(0) , favoring the micellization. The entropic term (ΔSmic(0)) is predominant at lower temperatures, and above ca. 55-65 °C, the enthalpic term (ΔHmic(0)) becomes prevalent, figuring a jointly driven process as the temperature increases. The interaction of these sulfobetaines with different polymers was also studied by ITC. Among the polymers studied, only two induced the formation of micellar aggregates at lower surfactant concentration: poly(acrylic acid), PAA, probably due to the formation of hydrogen bonds between the carboxylic group of the polymer and the sulfonate group of the surfactant, and poly(sodium 4-styrenesulfonate), PSS, probably due to the incorporation of the hydrophobic styrene group into the micelles. The prevalence of the hydrophobic and not the electrostatic contributions to the interaction between sulfobetaine and PSS was confirmed by an increased interaction enthalpy in the presence of electrolytes (NaCl) and by the observation of a significant temperature dependence, the latter consistent with the proposed removal of hydrophobic groups from water.

Last Instar Larvae And Pupae Of Ourocnemis Archytas And Anteros Formosus (lepidoptera: Riodinidae), With A Summary Of Known Host Plants For The Tribe Helicopini.

Last instar larvae and pupae of Ourocnemis archytas (Lepidoptera: Riodinidae) are described for the first time and compared with those of Anteros formosus, which are also described in detail. Last instars of both species present body covered with long white plumose setae, a row of orange balloon setae on the prothoracic shield, and clusters of perforated cupola organs (PCOs) near the spiracles; differences are the black cephalic capsule, the placement and format of balloon setae cluster, and the presence of enlarged black tips on some plumose setae. Pupae of O. archytas resemble that of Anteros, covered with the last instar setae and with no balloon setae. Characteristics of the immature stages of these two genera could be useful to establish the still unresolved relationship between them. A summary of the host plants of Helicopini is presented, showing a polyphagous pattern for Anteros, recorded in 21 host plant families, which contrasts with the specialized diet observed in Helicopis and Sarota. 

Two-component System Vicrk Regulates Functions Associated With Establishment Of Streptococcus Sanguinis In Biofilms.

Streptococcus sanguinis is a commensal pioneer colonizer of teeth and an opportunistic pathogen of infectious endocarditis. The establishment of S. sanguinis in host sites likely requires dynamic fitting of the cell wall in response to local stimuli. In this study, we investigated the two-component system (TCS) VicRK in S. sanguinis (VicRKSs), which regulates genes of cell wall biogenesis, biofilm formation, and virulence in opportunistic pathogens. A vicK knockout mutant obtained from strain SK36 (SKvic) showed slight reductions in aerobic growth and resistance to oxidative stress but an impaired ability to form biofilms, a phenotype restored in the complemented mutant. The biofilm-defective phenotype was associated with reduced amounts of extracellular DNA during aerobic growth, with reduced production of H2O2, a metabolic product associated with DNA release, and with inhibitory capacity of S. sanguinis competitor species. No changes in autolysis or cell surface hydrophobicity were detected in SKvic. Reverse transcription-quantitative PCR (RT-qPCR), electrophoretic mobility shift assays (EMSA), and promoter sequence analyses revealed that VicR directly regulates genes encoding murein hydrolases (SSA_0094, cwdP, and gbpB) and spxB, which encodes pyruvate oxidase for H2O2 production. Genes previously associated with spxB expression (spxR, ccpA, ackA, and tpK) were not transcriptionally affected in SKvic. RT-qPCR analyses of S. sanguinis biofilm cells further showed upregulation of VicRK targets (spxB, gbpB, and SSA_0094) and other genes for biofilm formation (gtfP and comE) compared to expression in planktonic cells. This study provides evidence that VicRKSs regulates functions crucial for S. sanguinis establishment in biofilms and identifies novel VicRK targets potentially involved in hydrolytic activities of the cell wall required for these functions.

Ant-caterpillar Antagonism At The Community Level: Interhabitat Variation Of Tritrophic Interactions In A Neotropical Savanna.

Ant foraging on foliage can substantially affect how phytophagous insects use host plants and represents a high predation risk for caterpillars, which are important folivores. Ant-plant-herbivore interactions are especially pervasive in cerrado savanna due to continuous ant visitation to liquid food sources on foliage (extrafloral nectaries, insect honeydew). While searching for liquid rewards on plants, aggressive ants frequently attack or kill insect herbivores, decreasing their numbers. Because ants vary in diet and aggressiveness, their effect on herbivores also varies. Additionally, the differential occurrence of ant attractants (plant and insect exudates) on foliage produces variable levels of ant foraging within local floras and among localities. Here, we investigate how variation of ant communities and of traits among host plant species (presence or absence of ant attractants) can change the effect of carnivores (predatory ants) on herbivore communities (caterpillars) in a cerrado savanna landscape. We sampled caterpillars and foliage-foraging ants in four cerrado localities (70-460 km apart). We found that: (i) caterpillar infestation was negatively related with ant visitation to plants; (ii) this relationship depended on local ant abundance and species composition, and on local preference by ants for plants with liquid attractants; (iii) this was not related to local plant richness or plant size; (iv) the relationship between the presence of ant attractants and caterpillar abundance varied among sites from negative to neutral; and (v) caterpillars feeding on plants with ant attractants are more resistant to ant predation than those feeding on plants lacking attractants. Liquid food on foliage mediates host plant quality for lepidopterans by promoting generalized ant-caterpillar antagonism. Our study in cerrado shows that the negative effects of generalist predatory ants on herbivores are detectable at a community level, affecting patterns of abundance and host plant use by lepidopterans. The magnitude of ant-induced effects on caterpillar occurrence across the cerrado landscape may depend on how ants use plants locally and how they respond to liquid food on plants at different habitats. This study enhances the relevance of plant-ant and ant-herbivore interactions in cerrado and highlights the importance of a tritrophic perspective in this ant-rich environment.

Clustering Of Water Bodies In Unpolluted And Polluted Environments Based On Escherichia Coli Phylogroup Abundance Using A Simple Interaction Database.

Different types of water bodies, including lakes, streams, and coastal marine waters, are often susceptible to fecal contamination from a range of point and nonpoint sources, and have been evaluated using fecal indicator microorganisms. The most commonly used fecal indicator is Escherichia coli, but traditional cultivation methods do not allow discrimination of the source of pollution. The use of triplex PCR offers an approach that is fast and inexpensive, and here enabled the identification of phylogroups. The phylogenetic distribution of E. coli subgroups isolated from water samples revealed higher frequencies of subgroups A1 and B23 in rivers impacted by human pollution sources, while subgroups D1 and D2 were associated with pristine sites, and subgroup B1 with domesticated animal sources, suggesting their use as a first screening for pollution source identification. A simple classification is also proposed based on phylogenetic subgroup distribution using the w-clique metric, enabling differentiation of polluted and unpolluted sites.

National Institutes Of Health Consensus Development Project On Criteria For Clinical Trials In Chronic Graft-versus-host Disease: I. The 2014 Diagnosis And Staging Working Group Report.

The 2005 National Institutes of Health (NIH) Consensus Conference proposed new criteria for diagnosing and scoring the severity of chronic graft-versus-host disease (GVHD). The 2014 NIH consensus maintains the framework of the prior consensus with further refinement based on new evidence. Revisions have been made to address areas of controversy or confusion, such as the overlap chronic GVHD subcategory and the distinction between active disease and past tissue damage. Diagnostic criteria for involvement of mouth, eyes, genitalia, and lungs have been revised. Categories of chronic GVHD should be defined in ways that indicate prognosis, guide treatment, and define eligibility for clinical trials. Revisions have been made to focus attention on the causes of organ-specific abnormalities. Attribution of organ-specific abnormalities to chronic GVHD has been addressed. This paradigm shift provides greater specificity and more accurately measures the global burden of disease attributed to GVHD, and it will facilitate biomarker association studies.

Contrasting Effects Of Land Use Intensity And Exotic Host Plants On The Specialization Of Interactions In Plant-herbivore Networks.

Human land use tends to decrease the diversity of native plant species and facilitate the invasion and establishment of exotic ones. Such changes in land use and plant community composition usually have negative impacts on the assemblages of native herbivorous insects. Highly specialized herbivores are expected to be especially sensitive to land use intensification and the presence of exotic plant species because they are neither capable of consuming alternative plant species of the native flora nor exotic plant species. Therefore, higher levels of land use intensity might reduce the proportion of highly specialized herbivores, which ultimately would lead to changes in the specialization of interactions in plant-herbivore networks. This study investigates the community-wide effects of land use intensity on the degree of specialization of 72 plant-herbivore networks, including effects mediated by the increase in the proportion of exotic plant species. Contrary to our expectation, the net effect of land use intensity on network specialization was positive. However, this positive effect of land use intensity was partially canceled by an opposite effect of the proportion of exotic plant species on network specialization. When we analyzed networks composed exclusively of endophagous herbivores separately from those composed exclusively of exophagous herbivores, we found that only endophages showed a consistent change in network specialization at higher land use levels. Altogether, these results indicate that land use intensity is an important ecological driver of network specialization, by way of reducing the local host range of herbivore guilds with highly specialized feeding habits. However, because the effect of land use intensity is offset by an opposite effect owing to the proportion of exotic host species, the net effect of land use in a given herbivore assemblage will likely depend on the extent of the replacement of native host species with exotic ones.

Human Mitochondrial Hsp70 (mortalin): Shedding Light On Atpase Activity, Interaction With Adenosine Nucleotides, Solution Structure And Domain Organization.

The human mitochondrial Hsp70, also called mortalin, is of considerable importance for mitochondria biogenesis and the correct functioning of the cell machinery. In the mitochondrial matrix, mortalin acts in the importing and folding process of nucleus-encoded proteins. The in vivo deregulation of mortalin expression and/or function has been correlated with age-related diseases and certain cancers due to its interaction with the p53 protein. In spite of its critical biological roles, structural and functional studies on mortalin are limited by its insoluble recombinant production. This study provides the first report of the production of folded and soluble recombinant mortalin when co-expressed with the human Hsp70-escort protein 1, but it is still likely prone to self-association. The monomeric fraction of mortalin presented a slightly elongated shape and basal ATPase activity that is higher than that of its cytoplasmic counterpart Hsp70-1A, suggesting that it was obtained in the functional state. Through small angle X-ray scattering, we assessed the low-resolution structural model of monomeric mortalin that is characterized by an elongated shape. This model adequately accommodated high resolution structures of Hsp70 domains indicating its quality. We also observed that mortalin interacts with adenosine nucleotides with high affinity. Thermally induced unfolding experiments indicated that mortalin is formed by at least two domains and that the transition is sensitive to the presence of adenosine nucleotides and that this process is dependent on the presence of Mg2+ ions. Interestingly, the thermal-induced unfolding assays of mortalin suggested the presence of an aggregation/association event, which was not observed for human Hsp70-1A, and this finding may explain its natural tendency for in vivo aggregation. Our study may contribute to the structural understanding of mortalin as well as to contribute for its recombinant production for antitumor compound screenings.

Reduced Lrp6 Expression And Increase In The Interaction Of Gsk3β With P53 Contribute To Podocyte Apoptosis In Diabetes Mellitus And Are Prevented By Green Tea.

In diabetes mellitus (DM), podocyte apoptosis leads to albuminuria and nephropathy progression. Low-density lipoprotein receptor-related protein 6 (LRP6) is WNT pathway receptor that is involved in podocyte death, adhesion and motility. Glycogen synthase kinase 3 (GSK3) interaction with p53 (GSK3-p53) promotes apoptosis in carcinoma cells. It is unknown if GSK3-p53 contributes to podocyte apoptosis in DM. In experimental DM, green tea (GT) reduces albuminuria by an unknown mechanism. In the present study, we assessed the role of the GSK3β-p53 in podocyte apoptosis and the effects of GT on these abnormalities. In diabetic spontaneously hypertensive rats (SHRs), GT prevents podocyte's p-LRP6 expression reduction, increased GSK3β-p53 and high p53 levels. In diabetic SHR rats, GT reduces podocyte apoptosis, foot process effacement and albuminuria. In immortalized mouse podocytes (iMPs), high glucose (HG), silencing RNA (siRNA) or blocking LRP6 (DKK-1) reduced p-LRP6 expression, leading to high GSK3β-p53, p53 expression, apoptosis and increased albumin influx. GSK3β blockade by BIO reduced GSK3β-p53 and podocyte apoptosis. In iMPs under HG, GT reduced apoptosis and the albumin influx by blocking GSK3β-p53 following the rise in p-LRP6 expression. These effects of GT were prevented by LRP6 siRNA or DKK-1. In conclusion, in DM, WNT inhibition, via LRP6, increases GSK3β-p53 and podocyte apoptosis. Maneuvers that inactivate GSK3β-p53, such as GT, may be renoprotective in DM.

Oropouche Virus Infection And Pathogenesis Is Restricted By Mavs, Irf-3, Irf-7, And Type I Ifn Signaling Pathways In Non-myeloid Cells.

Oropouche virus (OROV) is a member of the Orthobunyavirus genus in the Bunyaviridae family and a prominent cause of insect-transmitted viral disease in Central and South America. Despite its clinical relevance, little is known about OROV pathogenesis. To define the host defense pathways that control OROV infection and disease, we evaluated OROV pathogenesis and immune responses in primary cells and mice that were deficient in the RIG-I-like receptor signaling pathway (MDA5, RIG-I, or MAVS), downstream regulatory transcription factors (IRF-3 or IRF-7), IFN-β, or the receptor for type I IFN signaling (IFNAR). OROV replicated to higher levels in primary fibroblasts and dendritic cells lacking MAVS signaling, the transcription factors IRF-3 and IRF-7, or IFNAR. In mice, deletion of IFNAR, MAVS, or IRF-3 and IRF-7 resulted in uncontrolled OROV replication, hypercytokinemia, extensive liver damage, and death whereas wild-type (WT) congenic animals failed to develop disease. Unexpectedly, mice with a selective deletion of IFNAR on myeloid cells (CD11c Cre(+) Ifnar(f/f) or LysM Cre(+) Ifnar(f/f)) did not sustain enhanced disease with OROV or La Crosse virus, a closely related encephalitic orthobunyavirus. In bone marrow chimera studies, recipient irradiated Ifnar(-/-) mice reconstituted with WT hematopoietic cells sustained high levels of OROV replication and liver damage, whereas WT mice reconstituted with Ifnar(-/-) bone marrow were resistant to disease. Collectively, these results establish a dominant protective role for MAVS, IRF-3 and IRF-7, and IFNAR in restricting OROV virus infection and tissue injury, and suggest that IFN signaling in non-myeloid cells contributes to the host defense against orthobunyaviruses. Oropouche virus (OROV) is an emerging arthropod-transmitted orthobunyavirus that causes episodic outbreaks of a debilitating febrile illness in humans in countries of South and Central America. The continued expansion of the range and number of its arthropod vectors increases the likelihood that OROV will spread into new regions. At present, the pathogenesis of OROV in humans or other vertebrate animals remains poorly understood. To define cellular mechanisms of control of OROV infection, we performed infection studies in a series of primary cells and mice that were deficient in key innate immune genes involved in pathogen recognition and control. Our results establish that a MAVS-dependent type I IFN signaling pathway has a dominant role in restricting OROV infection and pathogenesis in vivo.

Characterization Of A Protein-protein Interaction Network Of The Cbl-interacting Protein Kinase 8 From Sugarcane.

Plants are sessile organisms and have evolved to tolerate a constantly changing environment. After the onset of different stress conditions, calcineurin B-like (CBL) proteins can sense calcium signals and activate CBL-interacting protein kinase (CIPK) proteins, which can phosphorylate downstream proteins to reestablish plant homeostasis. Previous studies in the bioenergy crop sugarcane showed that the ScCIPK8 gene is induced by drought stress and is also related to sucrose content. Here, we have characterized the protein-protein interactions of ScCIPK8 with six CBL proteins (ScCBL1, ScCBL2, ScCBL3, ScCBL6, ScCBL9, and ScCBL10). Yeast two-hybrid assays showed that ScCIPK8 interacts with ScCBL1, ScCBL3, and ScCBL6. Bimolecular fluorescence complementation assays confirmed in planta the interactions that were observed in yeast cells. These findings give insights on the regulatory networks related to sugar accumulation and drought stress responses in sugarcane.

Bay 41-2272 Activates Host Defence Against Local And Disseminated Candida Albicans Infections.

In our previous study, we have found that 5-cyclopropyl-2-[1-(2-fluoro-benzyl)-1H-pyrazolo[3,4-b]pyridine-3-yl]-pyrimidin-4-ylamine (BAY 41-2272), a guanylate cyclase agonist, activates human monocytes and the THP-1 cell line to produce the superoxide anion, increasing in vitro microbicidal activity, suggesting that this drug can be used to modulate immune functioning in primary immunodeficiency patients. In the present work, we investigated the potential of the in vivo administration of BAY 41-2272 for the treatment of Candida albicans and Staphylococcus aureus infections introduced via intraperitoneal and subcutaneous inoculation. We found that intraperitoneal treatment with BAY 41-2272 markedly increased macrophage-dependent cell influx to the peritoneum in addition to macrophage functions, such as spreading, zymosan particle phagocytosis and nitric oxide and phorbol myristate acetate-stimulated hydrogen peroxide production. Treatment with BAY 41-2272 was highly effective in reducing the death rate due to intraperitoneal inoculation of C. albicans, but not S. aureus. However, we found that in vitro stimulation of peritoneal macrophages with BAY 41-2272 markedly increased microbicidal activities against both pathogens. Our results show that the prevention of death by the treatment of C. albicans-infected mice with BAY 41-2272 might occur primarily by the modulation of the host immune response through macrophage activation.