Assessment Of Robustness On Analysis Using Headspace Solid-phase Microextraction And Comprehensive Two-dimensional Gas Chromatography Through Experimental Designs.

Plackett-Burman experimental design was applied for the robustness assessment of GC×GC-qMS (Comprehensive Two-Dimensional Gas Chromatography with Fast Quadrupolar Mass Spectrometric Detection) in quantitative and qualitative analysis of volatiles compounds from chocolate samples isolated by headspace solid-phase microextraction (HS-SPME). The influence of small changes around the nominal level of six factors deemed as important on peak areas (carrier gas flow rate, modulation period, temperature of ionic source, MS photomultiplier power, injector temperature and interface temperature) and of four factors considered as potentially influential on spectral quality (minimum and maximum limits of the scanned mass ranges, ions source temperature and photomultiplier power). The analytes selected for the study were 2,3,5-trimethylpyrazine, 2-octanone, octanal, 2-pentyl-furan, 2,3,5,6-tetramethylpyrazine, and 2-nonanone e nonanal. The factors pointed out as important on the robustness of the system were photomultiplier power for quantitative analysis and lower limit of mass scanning range for qualitative analysis.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Predictive Value Of Phase I Trials For Safety In Later Trials And Final Approved Dose: Analysis Of 61 Approved Cancer Drugs.

Phase I trials use a small number of patients to define a maximum tolerated dose (MTD) and the safety of new agents. We compared data from phase I and registration trials to determine whether early trials predicted later safety and final dose. We searched the U.S. Food and Drug Administration (FDA) website for drugs approved in nonpediatric cancers (January 1990-October 2012). The recommended phase II dose (R2PD) and toxicities from phase I were compared with doses and safety in later trials. In 62 of 85 (73%) matched trials, the dose from the later trial was within 20% of the RP2D. In a multivariable analysis, phase I trials of targeted agents were less predictive of the final approved dose (OR, 0.2 for adopting ± 20% of the RP2D for targeted vs. other classes; P = 0.025). Of the 530 clinically relevant toxicities in later trials, 70% (n = 374) were described in phase I. A significant relationship (P = 0.0032) between increasing the number of patients in phase I (up to 60) and the ability to describe future clinically relevant toxicities was observed. Among 28,505 patients in later trials, the death rate that was related to drug was 1.41%. In conclusion, dosing based on phase I trials was associated with a low toxicity-related death rate in later trials. The ability to predict relevant toxicities correlates with the number of patients on the initial phase I trial. The final dose approved was within 20% of the RP2D in 73% of assessed trials.

Chemical Immobilization Of Crosslinked Polymeric Ionic Liquids On Nitinol Wires Produces Highly Robust Sorbent Coatings For Solid-phase Microextraction.

Super elastic nitinol (NiTi) wires were exploited as highly robust supports for three distinct crosslinked polymeric ionic liquid (PIL)-based coatings in solid-phase microextraction (SPME). The oxidation of NiTi wires in a boiling (30%w/w) H2O2 solution and subsequent derivatization in vinyltrimethoxysilane (VTMS) allowed for vinyl moieties to be appended to the surface of the support. UV-initiated on-fiber copolymerization of the vinyl-substituted NiTi support with monocationic ionic liquid (IL) monomers and dicationic IL crosslinkers produced a crosslinked PIL-based network that was covalently attached to the NiTi wire. This alteration alleviated receding of the coating from the support, which was observed for an analogous crosslinked PIL applied on unmodified NiTi wires. A series of demanding extraction conditions, including extreme pH, pre-exposure to pure organic solvents, and high temperatures, were applied to investigate the versatility and robustness of the fibers. Acceptable precision of the model analytes was obtained for all fibers under these conditions. Method validation by examining the relative recovery of a homologous group of phthalate esters (PAEs) was performed in drip-brewed coffee (maintained at 60 °C) by direct immersion SPME. Acceptable recoveries were obtained for most PAEs in the part-per-billion level, even in this exceedingly harsh and complex matrix.

The Lea Grating Test In Assessing Detection Grating Acuity In Normal Infants Less Than 4 Months Of Age.

To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.

Elevated Cetp Activity During Acute Phase Of Myocardial Infarction Is Independently Associated With Endothelial Dysfunction And Adverse Clinical Outcome.

Recent data suggests that cholesteryl ester transfer protein (CETP) activity may interact with acute stress conditions via inflammatory-oxidative response and thrombogenesis. We investigated this assumption in patients with ST-elevation myocardial infarction (STEMI). Consecutive patients with STEMI (n = 116) were enrolled <24-h of symptoms onset and were followed for 180 days. Plasma levels of C-reactive protein (CRP), interleukin-2 (IL-2), tumor necrosis factor (TNFα), 8-isoprostane, nitric oxide (NOx) and CETP activity were measured at enrollment (D1) and at fifth day (D5). Flow-mediated dilation (FMD) was assessed by ultrasound and coronary thrombus burden (CTB) was evaluated by angiography. Neither baseline nor the change of CETP activity from D1 to D5 was associated with CRP, IL-2, TNFα, 8-isoprostane levels or CTB. The rise in NOx from D1 to D5 was inferior [3.5(-1; 10) vs. 5.5(-1; 12); p < 0.001] and FMD was lower [5.9(5.5) vs. 9.6(6.6); p = 0.047] in patients with baseline CETP activity above the median value than in their counterparts. Oxidized HDL was measured by thiobarbituric acid reactive substances (TBARS) in isolated HDL particles and increased from D1 to D5, and remaining elevated at D30. The change in TBARS content in HDL was associated with CETP activity (r = 0.72; p = 0.014) and FMD (r = -0.61; p = 0.046). High CETP activity at admission was associated with the incidence of sudden death and recurrent MI at 30 days (OR 12.8; 95% CI 1.25-132; p = 0.032) and 180 days (OR 3.3; 95% CI 1.03-10.7; p = 0.044). An enhanced CETP activity during acute phase of STEMI is independently associated with endothelial dysfunction and adverse clinical outcome.

Evaluation Of The Location Of Capsules Swallowed With Food During The Pharyngeal Phase Triggering In Asymptomatic Adults.

To assess the location of hard gelatin capsules in the pharyngeal phase triggering among asymptomatic adults. The location of the bolus during the pharyngeal phase triggering provides information about the sensorimotor model of the beginning of deglutition onset. To evaluate the location of hard gelatin capsules in the pharyngeal phase triggering among asymptomatic adults. A videofluoroscopy swallowing study was carried out in 60 subjects (14 male and 46 female participants) aged between 27 and 55 years, who were evaluated with hard gelatin capsules #00 and #3 containing barium sulfate, swallowed with liquid food and pudding, in free volume. The first laryngeal elevation movement was the criterion to locate the pharyngeal phase triggering. Statistical analysis was based on the McNemar test. Capsule #3 presented higher percentage of location in the tongue dorsum compared to capsule #00, and capsule #00 presented higher percentage of location in the tongue base and vallecula compared to capsule #3. There was a difference between different capsules swallowed with liquid (p=0.016) and pudding (p=0.037). The capsule size influenced the location of the pharyngeal phase triggering. Smaller capsules started pharyngeal phase in the most anterior region (tongue dorsum) compared to larger capsules.

Use Of Experimental Design To Optimize A Triple-potential Waveform To Develop A Method For The Determination Of Streptomycin And Dihydrostreptomycin In Pharmaceutical Veterinary Dosage Forms By Hplc-pad.

An HPLC-PAD method using a gold working electrode and a triple-potential waveform was developed for the simultaneous determination of streptomycin and dihydrostreptomycin in veterinary drugs. Glucose was used as the internal standard, and the triple-potential waveform was optimized using a factorial and a central composite design. The optimum potentials were as follows: amperometric detection, E1=-0.15V; cleaning potential, E2=+0.85V; and reactivation of the electrode surface, E3=-0.65V. For the separation of the aminoglycosides and the internal standard of glucose, a CarboPac™ PA1 anion exchange column was used together with a mobile phase consisting of a 0.070 mol L(-1) sodium hydroxide solution in the isocratic elution mode with a flow rate of 0.8 mL min(-1). The method was validated and applied to the determination of streptomycin and dihydrostreptomycin in veterinary formulations (injection, suspension and ointment) without any previous sample pretreatment, except for the ointments, for which a liquid-liquid extraction was required before HPLC-PAD analysis. The method showed adequate selectivity, with an accuracy of 98-107% and a precision of less than 3.9%.

Determination Of Tetrakis(hydroxymethyl)phosphonium Sulfate In Commercial Formulations And Cooling Water By Capillary Electrophoresis With Contactless Conductivity Detection.

A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.

Human Herpesvirus Infections Of The Central Nervous System: Laboratory Diagnosis Based On Dna Detection By Nested Pcr In Plasma And Cerebrospinal Fluid Samples.

Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.

Molecularly Imprinted Solid Phase Extraction Of Fluconazole From Pharmaceutical Formulations.

This work encompasses a direct and coherent strategy to synthesise a molecularly imprinted polymer (MIP) capable of extracting fluconazole from its sample. The MIP was successfully prepared from methacrylic acid (functional monomer), ethyleneglycoldimethacrylate (crosslinker) and acetonitrile (porogenic solvent) in the presence of fluconazole as the template molecule through a non-covalent approach. The non-imprinted polymer (NIP) was prepared following the same synthetic scheme, but in the absence of the template. The data obtained from scanning electronic microscopy, infrared spectroscopy, thermogravimetric and nitrogen Brunauer-Emmett-Teller plot helped to elucidate the structural as well as the morphological characteristics of the MIP and NIP. The application of MIP as a sorbent was demonstrated by packing it in solid phase extraction cartridges to extract fluconazole from commercial capsule samples through an offline analytical procedure. The quantification of fluconazole was accomplished through UPLC-MS, which resulted in LOD≤1.63×10(-10) mM. Furthermore, a high percentage recovery of 91±10% (n=9) was obtained. The ability of the MIP for selective recognition of fluconazole was evaluated by comparison with the structural analogues, miconazole, tioconazole and secnidazole, resulting in percentage recoveries of 51, 35 and 32%, respectively.

Detection Of Explosives On The Surface Of Banknotes By Raman Hyperspectral Imaging And Independent Component Analysis.

The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).

Are Human Peripheral Nerves Sensitive To X-ray Imaging?

Diagnostic imaging techniques play an important role in assessing the exact location, cause, and extent of a nerve lesion, thus allowing clinicians to diagnose and manage more effectively a variety of pathological conditions, such as entrapment syndromes, traumatic injuries, and space-occupying lesions. Ultrasound and nuclear magnetic resonance imaging are becoming useful methods for this purpose, but they still lack spatial resolution. In this regard, recent phase contrast x-ray imaging experiments of peripheral nerve allowed the visualization of each nerve fiber surrounded by its myelin sheath as clearly as optical microscopy. In the present study, we attempted to produce high-resolution x-ray phase contrast images of a human sciatic nerve by using synchrotron radiation propagation-based imaging. The images showed high contrast and high spatial resolution, allowing clear identification of each fascicle structure and surrounding connective tissue. The outstanding result is the detection of such structures by phase contrast x-ray tomography of a thick human sciatic nerve section. This may further enable the identification of diverse pathological patterns, such as Wallerian degeneration, hypertrophic neuropathy, inflammatory infiltration, leprosy neuropathy and amyloid deposits. To the best of our knowledge, this is the first successful phase contrast x-ray imaging experiment of a human peripheral nerve sample. Our long-term goal is to develop peripheral nerve imaging methods that could supersede biopsy procedures.

Towards A Deeper Understanding Of Structural Biomass Recalcitrance Using Phase-contrast Tomography.

The development of technological routes to convert lignocellulosic biomass to liquid fuels requires an in-depth understanding of the cell wall architecture of substrates. Essential pretreatment processes are conducted to reduce biomass recalcitrance and usually increase the reactive surface area. Quantitative three-dimensional information about both bulk and surface structural features of substrates needs to be obtained to expand our knowledge of substrates. In this work, phase-contrast tomography (PCT) was used to gather information about the structure of a model lignocellulosic biomass (piassava fibers). The three-dimensional cellular organization of piassava fibers was characterized by PCT using synchrotron radiation. This technique enabled important physical features that describe the substrate piassava fibers to be visualized and quantified. The external surface area of a fiber and internal surface area of the pores in a fiber could be determined separately. More than 96% of the overall surface area available to enzymes was in the bulk substrate. The pore surface area and length exhibited a positive linear relationship, where the slope of this relationship depended on the plant tissue. We demonstrated that PCT is a powerful tool for the three-dimensional characterization of the cell wall features related to biomass recalcitrance. Original and relevant quantitative information about the structural features of the analyzed material were obtained. The data obtained by PCT can be used to improve processing routes to efficiently convert biomass feedstock into sugars.

A screening method for detection of hexavalent chromium levels in soils

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.