6 resultados para Histopathological criteria
em Repositório da Produção Científica e Intelectual da Unicamp
Resumo:
In Brazil, the consumption of extra-virgin olive oil (EVOO) is increasing annually, but there are no experimental studies concerning the phenolic compound contents of commercial EVOO. The aim of this work was to optimise the separation of 17 phenolic compounds already detected in EVOO. A Doehlert matrix experimental design was used, evaluating the effects of pH and electrolyte concentration. Resolution, runtime and migration time relative standard deviation values were evaluated. Derringer's desirability function was used to simultaneously optimise all 37 responses. The 17 peaks were separated in 19min using a fused-silica capillary (50μm internal diameter, 72cm of effective length) with an extended light path and 101.3mmolL(-1) of boric acid electrolyte (pH 9.15, 30kV). The method was validated and applied to 15 EVOO samples found in Brazilian supermarkets.
Resumo:
Muscle strength and functional independence are considered to be determinants of frailty levels among elderly people. The aim here was to compare lower-limb muscle strength (LLMS) with functional independence in relation to sex, age and number of frailty criteria, and to ascertain the influence of these variables on elderly outpatients' independence. Quantitative cross-sectional study, in a tertiary hospital. The study was conducted on 150 elderly outpatients of both sexes who were in a cognitive condition allowing oral communication, between October 2005 and October 2007. The following instruments were used: five-times sit-to-stand test (FTSST), Functional Independence Measurement (FIM) and Lawton's Instrumental Activities of Daily Living Scale (IADL). Descriptive, comparative, multivariate, univariate and Cronbach alpha analyses were performed. The mean time taken in the FTSST was 21.7 seconds; the mean score for FIM was 82.2 and for IADL was 21.2; 44.7% of the subjects presented 1-2 frailty criteria and 55.3% > 3 criteria. There was a significant association between LLMS and functional independence in relation to the number of frailty criteria, without homogeneity regarding sex and age. Functional independence showed significant influence from sex and LLMS. Elderly individuals with 1 or 2 frailty criteria presented greater independence in all FTSST scores. The subjects with higher LLMS presented better functional independence.
Resumo:
We compared the indication of laparoscopy for treatment of adnexal masses based on the risk scores and tumor diameters with the indication based on gynecology-oncologists' experience. This was a prospective study of 174 women who underwent surgery for adnexal tumors (116 laparotomies, 58 laparoscopies). The surgeries begun and completed by laparoscopy, with benign pathologic diagnosis, were considered successful. Laparoscopic surgeries that required conversion to laparotomy, led to a malignant diagnosis, or facilitated cyst rupture were considered failures. Two groups were defined for laparoscopy indication: (1) absence of American College of Obstetrics and Gynecology (ACOG) guideline for referral of high-risk adnexal masses criteria (ACOG negative) associated with 3 different tumor sizes (10, 12, and 14 cm); and (2) Index of Risk of Malignancy (IRM) with cutoffs at 100, 200, and 300, associated with the same 3 tumor sizes. Both groups were compared with the indication based on the surgeon's experience to verify whether the selection based on strict rules would improve the rate of successful laparoscopy. ACOG-negative and tumors ≤10 cm and IRM with a cutoff at 300 points and tumors ≤10cm resulted in the same best performance (78% success = 38/49 laparoscopies). However, compared with the results of the gynecology-oncologists' experience, those were not statistically significant. The selection of patients with adnexal mass to laparoscopy by the use of the ACOG guideline or IRM associated with tumor diameter had similar performance as the experience of gynecology-oncologists. Both methods are reproducible and easy to apply to all women with adnexal masses and could be used by general gynecologists to select women for laparoscopic surgery; however, referral to a gynecology-oncologist is advisable when there is any doubt.
Resumo:
The 2005 National Institutes of Health (NIH) Consensus Conference proposed new criteria for diagnosing and scoring the severity of chronic graft-versus-host disease (GVHD). The 2014 NIH consensus maintains the framework of the prior consensus with further refinement based on new evidence. Revisions have been made to address areas of controversy or confusion, such as the overlap chronic GVHD subcategory and the distinction between active disease and past tissue damage. Diagnostic criteria for involvement of mouth, eyes, genitalia, and lungs have been revised. Categories of chronic GVHD should be defined in ways that indicate prognosis, guide treatment, and define eligibility for clinical trials. Revisions have been made to focus attention on the causes of organ-specific abnormalities. Attribution of organ-specific abnormalities to chronic GVHD has been addressed. This paradigm shift provides greater specificity and more accurately measures the global burden of disease attributed to GVHD, and it will facilitate biomarker association studies.
Resumo:
Both high-fat diet and exposure to endocrine-disrupting chemicals have been implicated in susceptibility to pathological prostate lesions, but the consequences of combining the two have not yet been examined. We evaluated the effects of gestational and postnatal exposure to a high-fat diet (20% fat) and low doses of di-n-butyl phthalate (DBP; 5mg/kg/day), individually or in combination, on the tissue response and incidence of pathological lesions in the ventral prostate of adult gerbils. Continuous intake of a high-fat diet caused dyslipidemia, hypertrophy, and promoted the development of inflammatory, premalignant and malignant prostate lesions, even in the absence of obesity. Life-time DBP exposure was obesogenic and dyslipidemic and increased the incidence of premalignant prostate lesions. Combined exposure to DBP and a high-fat diet also caused prostate hypertrophy, but the effects were less severe than those of individual treatments; combined exposure neither induced an inflammatory response nor altered serum lipid content.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.