11 resultados para Histopathological aspects

em Repositório da Produção Científica e Intelectual da Unicamp


Relevância:

20.00% 20.00%

Publicador:

Resumo:

The current dominance of African runners in long-distance running is an intriguing phenomenon that highlights the close relationship between genetics and physical performance. Many factors in the interesting interaction between genotype and phenotype (eg, high cardiorespiratory fitness, higher hemoglobin concentration, good metabolic efficiency, muscle fiber composition, enzyme profile, diet, altitude training, and psychological aspects) have been proposed in the attempt to explain the extraordinary success of these runners. Increasing evidence shows that genetics may be a determining factor in physical and athletic performance. But, could this also be true for African long-distance runners? Based on this question, this brief review proposed the role of genetic factors (mitochondrial deoxyribonucleic acid, the Y chromosome, and the angiotensin-converting enzyme and the alpha-actinin-3 genes) in the amazing athletic performance observed in African runners, especially the Kenyans and Ethiopians, despite their environmental constraints.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Hsp90 is a molecular chaperone essential for cell viability in eukaryotes that is associated with the maturation of proteins involved in important cell functions and implicated in the stabilization of the tumor phenotype of various cancers, making this chaperone a notably interesting therapeutic target. Celastrol is a plant-derived pentacyclic triterpenoid compound with potent antioxidant, anti-inflammatory and anticancer activities; however, celastrol's action mode is still elusive. In this work, we investigated the effect of celastrol on the conformational and functional aspects of Hsp90α. Interestingly, celastrol appeared to target Hsp90α directly as the compound induced the oligomerization of the chaperone via the C-terminal domain as demonstrated by experiments using a deletion mutant. The nature of the oligomers was investigated by biophysical tools demonstrating that a two-fold excess of celastrol induced the formation of a decameric Hsp90α bound throughout the C-terminal domain. When bound, celastrol destabilized the C-terminal domain. Surprisingly, standard chaperone functional investigations demonstrated that neither the in vitro chaperone activity of protecting against aggregation nor the ability to bind a TPR co-chaperone, which binds to the C-terminus of Hsp90α, were affected by celastrol. Celastrol interferes with specific biological functions of Hsp90α. Our results suggest a model in which celastrol binds directly to the C-terminal domain of Hsp90α causing oligomerization. However, the ability to protect against protein aggregation (supported by our results) and to bind to TPR co-chaperones are not affected by celastrol. Therefore celastrol may act primarily by inducing specific oligomerization that affects some, but not all, of the functions of Hsp90α. To the best of our knowledge, this study is the first work to use multiple probes to investigate the effect that celastrol has on the stability and oligomerization of Hsp90α and on the binding of this chaperone to Tom70. This work provides a novel mechanism by which celastrol binds Hsp90α.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The purpose of this study was to compare the behavior of full-term small-for-gestational age (SGA) with full-term appropriate-for gestational age (AGA) infants in the first year of life. We prospectively evaluated 68 infants in the 2nd month, 67 in the 6th month and 69 in the 12th month. The Bayley Scales of Infant Development-II were used, with emphasis on the Behavior Rating Scale (BRS). The groups were similar concerning the item interest in test materials and stimuli; there was a trend toward differences in the items negative affect, hypersensitivity to test materials and adaptation to change in test materials. The mean of Raw Score was significantly lower for the SGA group in the items predominant state, liability of state of arousal, positive affect, soothability when upset, energy, exploration of objects and surroundings, orientation toward examiner. A lower BRS score was associated with the SGA group in the 2nd month.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Membrane microdomains enriched in cholesterol, sphingolipids (rafts), and specific proteins are involved in important physiological functions. However their structure, size and stability are still controversial. Given that detergent-resistant membranes (DRMs) are in the liquid-ordered state and are rich in raft-like components, they might correspond to rafts at least to some extent. Here we monitor the lateral order of biological membranes by characterizing DRMs from erythrocytes obtained with Brij-98, Brij-58, and TX-100 at 4 °C and 37 °C. All DRMs were enriched in cholesterol and contained the raft markers flotillin-2 and stomatin. However, sphingomyelin (SM) was only found to be enriched in TX-100-DRMs - a detergent that preferentially solubilizes the membrane inner leaflet - while Band 3 was present solely in Brij-DRMs. Electron paramagnetic resonance spectra showed that the acyl chain packing of Brij-DRMs was lower than TX-100-DRMs, providing evidence of their diverse lipid composition. Fatty acid analysis revealed that the SM fraction of the DRMs was enriched in lignoceric acid, which should specifically contribute to the resistance of SM to detergents. These results indicate that lipids from the outer leaflet, particularly SM, are essential for the formation of the liquid-ordered phase of DRMs. At last, the differential solubilization process induced by Brij-98 and TX-100 was monitored using giant unilamellar vesicles. This study suggests that Brij and TX-100-DRMs reflect different degrees of lateral order of the membrane microdomains. Additionally, Brij DRMs are composed by both inner and outer leaflet components, making them more physiologically relevant than TX-100-DRMs to the studies of membrane rafts.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The effectiveness of low-level laser therapy in muscle regeneration is still not well known. To investigate the effects of laser irradiation during muscle healing. For this purpose, 63 rats were distributed to 3 groups: non-irradiated control group (CG); group irradiated at 10 J/cm(2) (G10); and group irradiated at 50 J/cm(2) (G50). Each group was divided into 3 different subgroups (n=7), and on days 7, 14 and 21 post-injury the rats were sacrificed. Seven days post-surgery, the CG showed destroyed zones and extensive myofibrillar degeneration. For both treated groups, the necrosis area was smaller compared to the CG. On day 14 post-injury, treated groups demonstrated better tissue organization, with newly formed muscle fibers compared to the CG. On the 21(st) day, the irradiated groups showed similar patterns of tissue repair, with improved muscle structure at the site of the injury, resembling uninjured muscle tissue organization. Regarding collagen deposition, the G10 showed an increase in collagen synthesis. In the last period evaluated, both treated groups showed statistically higher values in comparison with the CG. Furthermore, laser irradiation at 10 J/cm(2) produced a down-regulation of cyclooxygenase 2 (Cox-2) immunoexpression on day 7 post-injury. Moreover, Cox-2 immunoexpression was decreased in both treated groups on day 14. Laser therapy at both fluencies stimulated muscle repair through the formation of new muscle fiber, increase in collagen synthesis, and down-regulation of Cox-2 expression.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The inflation pressure of the endotracheal tube cuff can cause ischemia of the tracheal mucosa at high pressures; thus, it can cause important tracheal morbidity and tracheal microaspiration of the oropharyngeal secretion, or it can even cause pneumonia associated with mechanical ventilation if the pressure of the cuff is insufficient. In order to investigate the effectiveness of the RUSCH® 7.5 mm endotracheal tube cuff, this study was designed to investigate the physical and mechanical aspects of the cuff in contact with the trachea. For this end, we developed an in vitro experimental model to assess the flow of dye (methylene blue) by the inflated cuff on the wall of the artificial material. We also designed an in vivo study with 12 Large White pigs under endotracheal intubation. We instilled the same dye in the oral cavity of the animals, and we analyzed the presence or not of leakage in the trachea after the region of the cuff after their deaths (animal sacrifice). All cuffs were inflated at the pressure of 30 cmH2O. We observed the passage of fluids through the cuff in all in vitro and in vivo experimental models. We conclude that, as well as several other cuff models in the literature, the RUSCH® 7.5 mm tube cuffs are also not able to completely seal the trachea and thus prevent aspiration of oropharyngeal secretions. Other prevention measures should be taken.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Both high-fat diet and exposure to endocrine-disrupting chemicals have been implicated in susceptibility to pathological prostate lesions, but the consequences of combining the two have not yet been examined. We evaluated the effects of gestational and postnatal exposure to a high-fat diet (20% fat) and low doses of di-n-butyl phthalate (DBP; 5mg/kg/day), individually or in combination, on the tissue response and incidence of pathological lesions in the ventral prostate of adult gerbils. Continuous intake of a high-fat diet caused dyslipidemia, hypertrophy, and promoted the development of inflammatory, premalignant and malignant prostate lesions, even in the absence of obesity. Life-time DBP exposure was obesogenic and dyslipidemic and increased the incidence of premalignant prostate lesions. Combined exposure to DBP and a high-fat diet also caused prostate hypertrophy, but the effects were less severe than those of individual treatments; combined exposure neither induced an inflammatory response nor altered serum lipid content.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This study aimed to check for any significant differences in perceived quality of life, specifically aspects of a physical nature, among volunteers who are more physically active and those less physically active in a university community. The sample consisted of 1,966 volunteers in a university community in Brazil. To assess physical activity levels, volunteers responded to the International Physical Activity Questionnaire (IPAQ), and to analyse the perception of quality of life they responded to WHOQOL-bref, which is classified into three groups according to level of physical activity, taking into account the metabolic equivalent index (MET) over a full week. For comparison, consideration was given to the first and third tertiles, respectively, namely groups of more and less active students. The results indicated that individuals who engaged in more physical activity had a more positive perception of quality of life compared to those who were less active in physical aspects related to the ability to work, energy for day-to-day activities and locomotion.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Type II 3β-hydroxysteroid dehydrogenase/Δ5-Δ4-isomerase (3β-HSD2), encoded by the HSD3B2 gene, is a key enzyme involved in the biosynthesis of all the classes of steroid hormones. Deleterious mutations in the HSD3B2 gene cause the classical deficiency of 3β-HSD2, which is a rare autosomal recessive disease that leads to congenital adrenal hyperplasia (CAH). CAH is the most frequent cause of ambiguous genitalia and adrenal insufficiency in newborn infants with variable degrees of salt losing. Here we report the molecular and structural analysis of the HSD3B2 gene in a 46,XY child, who was born from consanguineous parents, and presented with ambiguous genitalia and salt losing. The patient carries a homozygous nucleotide c.665C>A change in exon 4 that putatively substitutes the proline at codon 222 for glutamine. Molecular homology modeling of normal and mutant 3β-HSD2 enzymes emphasizes codon 222 as an important residue for the folding pattern of the enzyme and validates a suitable model for analysis of new mutations.