3 resultados para Hemiptera
em Repositório da Produção Científica e Intelectual da Unicamp
Resumo:
The reproductive capacity between Triatoma lenti and Triatoma sherlocki was observed in order to verify the fertility and viability of the offspring. Cytogenetic, morphological and morphometric approaches were used to analyze the differences that were inherited. Experimental crosses were performed in both directions. The fertility rate of the eggs in crosses involving T. sherlocki females was 65% and 90% in F1 and F2 offspring, respectively. In reciprocal crosses, it was 7% and 25% in F1 and F2 offspring, respectively. The cytogenetic analyses of the male meiotic process of the hybrids were performed using lacto-acetic orcein, C-banding and Feulgen techniques. The male F1 offspring presented normal chromosome behavior, a finding that was similar to those reported in parental species. However, cytogenetic analysis of F2 offspring showed errors in chromosome pairing. This post-zygotic isolation, which prevents hybrids in nature, may represent the collapse of the hybrid. This phenomenon is due to a genetic dysregulation that occurs in the chromosomes of F1. The results were similar in the hybrids from both crosses. Morphological features, such as color and size of connexive and the presence of red-orange rings on the femora, were similar to T. sherlocki, while wins size was similar to T. lenti in F1 offspring. The eggshells showed characteristics that were similar to species of origin, whereas the median process of the pygophore resulted in intermediate characteristics in the F1 and a segregating pattern in F2 offspring. Geometric morphometric techniques used on the wings showed that both F1 and F2 offspring were similar to T. lenti. These studies on the reproductive capacity between T. lenti and T. sherlocki confirm that both species are evolutionarily closed; hence, they are included in the brasiliensis subcomplex. The extremely reduced fertility observed in the F2 hybrids confirmed the specific status of the species that were analyzed.
Resumo:
Triatomine surveillance in rural areas, artificial ecotypes, and natural ecotopes of the cities of Caturama, Ibipitanga, Macaúbas, and Seabra in the south-central region of the Brazilian state of Bahia was carried out between 2008 and 2013. Natural infection by Trypanosoma cruzi was evaluated in the specimens collected to monitor vectors of Chagas disease. A total of 1,357 specimens were collected, and four species were identified: Triatoma sordida (83%), Triatoma lenti (16.4%), Triatoma pseudomaculata (0.5%), and Panstrongylus geniculatus (0.1%). Triatoma sordida was found in four cities, only 0.7% in intradomiciliary environments. Triatoma lenti was found only in Macaúbas; 8.5% were found in intradomiciliary environments, 88.3% in peridomiciliary environments, and 3.1% in sylvatic environments. Natural infection by T. cruzi was 0.5% for T. sordida and 3.1% T. lenti. All of these cases were found in peridomiciliary environments of Macaúbas. As the results show, triatomines were found in intradomiciliary environments in three cities that were surveyed in the south-central region of the state of Bahia. Thus, an epidemiologic survey should be performed to avoid the risk of transmission to the population.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.