8 resultados para HYBRID ELECTRIC VEHICLE IN LOW SCALE (HELVIS) MINI-HEV
em Repositório da Produção Científica e Intelectual da Unicamp
Resumo:
Intermittent fasting (IF) is an often-used intervention to decrease body mass. In male Sprague-Dawley rats, 24 hour cycles of IF result in light caloric restriction, reduced body mass gain, and significant decreases in the efficiency of energy conversion. Here, we study the metabolic effects of IF in order to uncover mechanisms involved in this lower energy conversion efficiency. After 3 weeks, IF animals displayed overeating during fed periods and lower body mass, accompanied by alterations in energy-related tissue mass. The lower efficiency of energy use was not due to uncoupling of muscle mitochondria. Enhanced lipid oxidation was observed during fasting days, whereas fed days were accompanied by higher metabolic rates. Furthermore, an increased expression of orexigenic neurotransmitters AGRP and NPY in the hypothalamus of IF animals was found, even on feeding days, which could explain the overeating pattern. Together, these effects provide a mechanistic explanation for the lower efficiency of energy conversion observed. Overall, we find that IF promotes changes in hypothalamic function that explain differences in body mass and caloric intake.
Resumo:
X-ray fluorescence (XRF) is a fast, low-cost, nondestructive, and truly multielement analytical technique. The objectives of this study are to quantify the amount of Na(+) and K(+) in samples of table salt (refined, marine, and light) and to compare three different methodologies of quantification using XRF. A fundamental parameter method revealed difficulties in quantifying accurately lighter elements (Z < 22). A univariate methodology based on peak area calibration is an attractive alternative, even though additional steps of data manipulation might consume some time. Quantifications were performed with good correlations for both Na (r = 0.974) and K (r = 0.992). A partial least-squares (PLS) regression method with five latent variables was very fast. Na(+) quantifications provided calibration errors lower than 16% and a correlation of 0.995. Of great concern was the observation of high Na(+) levels in low-sodium salts. The presented application may be performed in a fast and multielement fashion, in accordance with Green Chemistry specifications.
Resumo:
Although various abutment connections and materials have recently been introduced, insufficient data exist regarding the effect of stress distribution on their mechanical performance. The purpose of this study was to investigate the effect of different abutment materials and platform connections on stress distribution in single anterior implant-supported restorations with the finite element method. Nine experimental groups were modeled from the combination of 3 platform connections (external hexagon, internal hexagon, and Morse tapered) and 3 abutment materials (titanium, zirconia, and hybrid) as follows: external hexagon-titanium, external hexagon-zirconia, external hexagon-hybrid, internal hexagon-titanium, internal hexagon-zirconia, internal hexagon-hybrid, Morse tapered-titanium, Morse tapered-zirconia, and Morse tapered-hybrid. Finite element models consisted of a 4×13-mm implant, anatomic abutment, and lithium disilicate central incisor crown cemented over the abutment. The 49 N occlusal loading was applied in 6 steps to simulate the incisal guidance. Equivalent von Mises stress (σvM) was used for both the qualitative and quantitative evaluation of the implant and abutment in all the groups and the maximum (σmax) and minimum (σmin) principal stresses for the numerical comparison of the zirconia parts. The highest abutment σvM occurred in the Morse-tapered groups and the lowest in the external hexagon-hybrid, internal hexagon-titanium, and internal hexagon-hybrid groups. The σmax and σmin values were lower in the hybrid groups than in the zirconia groups. The stress distribution concentrated in the abutment-implant interface in all the groups, regardless of the platform connection or abutment material. The platform connection influenced the stress on abutments more than the abutment material. The stress values for implants were similar among different platform connections, but greater stress concentrations were observed in internal connections.
Resumo:
Uncoupling protein one (UCP1) is a mitochondrial inner membrane protein capable of uncoupling the electrochemical gradient from adenosine-5'-triphosphate (ATP) synthesis, dissipating energy as heat. UCP1 plays a central role in nonshivering thermogenesis in the brown adipose tissue (BAT) of hibernating animals and small rodents. A UCP1 ortholog also occurs in plants, and aside from its role in uncoupling respiration from ATP synthesis, thereby wasting energy, it plays a beneficial role in the plant response to several abiotic stresses, possibly by decreasing the production of reactive oxygen species (ROS) and regulating cellular redox homeostasis. However, the molecular mechanisms by which UCP1 is associated with stress tolerance remain unknown. Here, we report that the overexpression of UCP1 increases mitochondrial biogenesis, increases the uncoupled respiration of isolated mitochondria, and decreases cellular ATP concentration. We observed that the overexpression of UCP1 alters mitochondrial bioenergetics and modulates mitochondrial-nuclear communication, inducing the upregulation of hundreds of nuclear- and mitochondrial-encoded mitochondrial proteins. Electron microscopy analysis showed that these metabolic changes were associated with alterations in mitochondrial number, area and morphology. Surprisingly, UCP1 overexpression also induces the upregulation of hundreds of stress-responsive genes, including some involved in the antioxidant defense system, such as superoxide dismutase (SOD), glutathione peroxidase (GPX) and glutathione-S-transferase (GST). As a consequence of the increased UCP1 activity and increased expression of oxidative stress-responsive genes, the UCP1-overexpressing plants showed reduced ROS accumulation. These beneficial metabolic effects may be responsible for the better performance of UCP1-overexpressing lines in low pH, high salt, high osmolarity, low temperature, and oxidative stress conditions. Overexpression of UCP1 in the mitochondrial inner membrane induced increased uncoupling respiration, decreased ROS accumulation under abiotic stresses, and diminished cellular ATP content. These events may have triggered the expression of mitochondrial and stress-responsive genes in a coordinated manner. Because these metabolic alterations did not impair plant growth and development, UCP1 overexpression can potentially be used to create crops better adapted to abiotic stress conditions.
Resumo:
The vast majority of maternal deaths in low-and middle-income countries are preventable. Delay in obtaining access to appropriate health care is a fairly common problem which can be improved. The objective of this study was to explore the association between delay in providing obstetric health care and severe maternal morbidity/death. This was a multicentre cross-sectional study, involving 27 referral obstetric facilities in all Brazilian regions between 2009 and 2010. All women admitted to the hospital with a pregnancy-related cause were screened, searching for potentially life-threatening conditions (PLTC), maternal death (MD) and maternal near-miss (MNM) cases, according to the WHO criteria. Data on delays were collected by medical chart review and interview with the medical staff. The prevalence of the three different types of delays was estimated according to the level of care and outcome of the complication. For factors associated with any delay, the PR and 95%CI controlled for cluster design were estimated. A total of 82,144 live births were screened, with 9,555 PLTC, MNM or MD cases prospectively identified. Overall, any type of delay was observed in 53.8% of cases; delay related to user factors was observed in 10.2%, 34.6% of delays were related to health service accessibility and 25.7% were related to quality of medical care. The occurrence of any delay was associated with increasing severity of maternal outcome: 52% in PLTC, 68.4% in MNM and 84.1% in MD. Although this was not a population-based study and the results could not be generalized, there was a very clear and significant association between frequency of delay and severity of outcome, suggesting that timely and proper management are related to survival.
Resumo:
The overall prevalence of infertility was estimated to be 3.5-16.7% in developing countries and 6.9-9.3% in developed countries. Furthermore, according to reports from some regions of sub-Saharan Africa, the prevalence rate is 30-40%. The consequences of infertility and how it affects the lives of women in poor-resource settings, particularly in developing countries, has become an important issue to be discussed in reproductive health. In some societies, the inability to fulfill the desire to have children makes life difficult for the infertile couple. In many regions, infertility is considered a tragedy that affects not only the infertile couple or woman, but the entire family. This is a position paper which encompasses a review of the needs of low-income infertile couples, mainly those living in developing countries, regarding access to infertility care, including ART and initiatives to provide ART at low or affordable cost. Information was gathered from the databases MEDLINE, CENTRAL, POPLINE, EMBASE, LILACS, and ICTRP with the key words: infertility, low income, assisted reproductive technologies, affordable cost, low cost. There are few initiatives geared toward implementing ART procedures at low cost or at least at affordable cost in low-income populations. Nevertheless, from recent studies, possibilities have emerged for new low-cost initiatives that can help millions of couples to achieve the desire of having a biological child. It is necessary for healthcare professionals and policymakers to take into account these new initiatives in order to implement ART in resource-constrained settings.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física