68 resultados para Germination and vigor of seeds

em Repositório da Produção Científica e Intelectual da Unicamp


Relevância:

100.00% 100.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Ethanol consumption damages the prostate, and testosterone is known by anti-inflammatory role. The cytokines were investigated in the plasma and ventral prostate of UChB rats submitted or not to testosterone therapy by ELISA and Western blot, respectively. Additionally, inflammatory foci and mast cells were identified in the ventral prostate slides stained by hematoxylin and eosin and toluidine blue, respectively. Inflammatory foci were found in the ethanol-treated animals and absent after testosterone therapy. Plasma levels of IL-6 and IL-10 were not changed while TNFα and TFG-β1 were increased in the animals submitted testosterone therapy. Regarding to ventral prostate, IL-6 did not alter, while IL-10, TNFα, and TFG-β1 were increased after testosterone therapy. Ethanol increases NFR2 in addition to high number of intact and degranulated mast cell which were reduced after testosterone therapy. So, ethanol and testosterone differentially modulates the cytokines in the plasma and prostate.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

To evaluate associations between polymorphisms of the N-acetyltransferase 2 (NAT2), human 8-oxoguanine glycosylase 1 (hOGG1) and X-ray repair cross-complementing protein 1 (XRCC1) genes and risk of upper aerodigestive tract (UADT) cancer. A case-control study involving 117 cases and 224 controls was undertaken. The NAT2 gene polymorphisms were genotyped by automated sequencing and XRCC1 Arg399Gln and hOGG1 Ser326Cys polymorphisms were determined by Polymerase Chain Reaction followed by Restriction Fragment Length Polymorphism (PCR-RFLP) methods. Slow metabolization phenotype was significantly associated as a risk factor for the development of UADT cancer (p=0.038). Furthermore, haplotype of slow metabolization was also associated with UADT cancer (p=0.014). The hOGG1 Ser326Cys polymorphism (CG or GG vs. CC genotypes) was shown as a protective factor against UADT cancer in moderate smokers (p=0.031). The XRCC1 Arg399Gln polymorphism (GA or AA vs. GG genotypes), in turn, was a protective factor against UADT cancer only among never-drinkers (p=0.048). Interactions involving NAT2, XRCC1 Arg399Gln and hOGG1 Ser326Cys polymorphisms may modulate the risk of UADT cancer in this population.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The purpose of this study was to assess the efficacy and reproducibility of the cytologic diagnosis of salivary gland tumors (SGTs) using fine-needle aspiration cytology (FNAC). The study aimed to determine diagnostic accuracy, sensitivity, and specificity and to evaluate the extent of interobserver agreement. We retrospectively evaluated SGTs from the files of the Division of Pathology at the Clinics Hospital of São Paulo and Piracicaba Dental School between 2000 and 2006. We performed cytohistologic correlation in 182 SGTs. The sensitivity, specificity, positive predictive value, negative predictive value, and diagnostic accuracy were 94%, 100%, 100%, 100%, and 99%, respectively. The interobserver cytologic reproducibility showed significant statistical concordance (P < .0001). FNAC is an effective tool for performing a reliable preoperative diagnosis in SGTs and shows high diagnostic accuracy and consistent interobserver reproducibility. Further FNAC studies analyzing large samples of malignant SGTs and reactive salivary lesions are needed to confirm their accuracy.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Yellowing is an undesirable phenomenon that is common in people with white and grey hair. Because white hair has no melanin, the pigment responsible for hair colour, the effects of photodegradation are more visible in this type of hair. The origin of yellowing and its relation to photodegradation processes are not properly established, and many questions remain open in this field. In this work, the photodegradation of grey hair was investigated as a function of the wavelength of incident radiation, and its ultrastructure was determined, always comparing the results obtained for the white and black fibres present in grey hair with the results of white wool. The results presented herein indicate that the photobehaviour of grey hair irradiated with a mercury lamp or with solar radiation is dependent on the wavelength range of the incident radiation and on the initial shade of yellow in the sample. Two types of grey hair were used: (1) blended grey hair (more yellow) and (2) grey hair from a single-donor (less yellow). After exposure to a full-spectrum mercury lamp for 200 h, the blended white hair turned less yellow (the yellow-blue difference, Db(*) becomes negative, Db(*)=-6), whereas the white hair from the single-donor turned slightly yellower (Db(*)=2). In contrast, VIS+IR irradiation resulted in bleaching in both types of hair, whereas a thermal treatment (at 81 °C) caused yellowing of both types of hair, resulting in a Db(*)=3 for blended white hair and Db(*)=9 for single-donor hair. The identity of the yellow chromophores was investigated by UV-Vis spectroscopy. The results obtained with this technique were contradictory, however, and it was not possible to obtain a simple correlation between the sample shade of yellow and the absorption spectra. In addition, the results are discussed in terms of the morphology differences between the pigmented and non-pigmented parts of grey hair, the yellowing and bleaching effects of grey hair, and the occurrence of dark-follow reactions.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

High-throughput screening of physical, genetic and chemical-genetic interactions brings important perspectives in the Systems Biology field, as the analysis of these interactions provides new insights into protein/gene function, cellular metabolic variations and the validation of therapeutic targets and drug design. However, such analysis depends on a pipeline connecting different tools that can automatically integrate data from diverse sources and result in a more comprehensive dataset that can be properly interpreted. We describe here the Integrated Interactome System (IIS), an integrative platform with a web-based interface for the annotation, analysis and visualization of the interaction profiles of proteins/genes, metabolites and drugs of interest. IIS works in four connected modules: (i) Submission module, which receives raw data derived from Sanger sequencing (e.g. two-hybrid system); (ii) Search module, which enables the user to search for the processed reads to be assembled into contigs/singlets, or for lists of proteins/genes, metabolites and drugs of interest, and add them to the project; (iii) Annotation module, which assigns annotations from several databases for the contigs/singlets or lists of proteins/genes, generating tables with automatic annotation that can be manually curated; and (iv) Interactome module, which maps the contigs/singlets or the uploaded lists to entries in our integrated database, building networks that gather novel identified interactions, protein and metabolite expression/concentration levels, subcellular localization and computed topological metrics, GO biological processes and KEGG pathways enrichment. This module generates a XGMML file that can be imported into Cytoscape or be visualized directly on the web. We have developed IIS by the integration of diverse databases following the need of appropriate tools for a systematic analysis of physical, genetic and chemical-genetic interactions. IIS was validated with yeast two-hybrid, proteomics and metabolomics datasets, but it is also extendable to other datasets. IIS is freely available online at: http://www.lge.ibi.unicamp.br/lnbio/IIS/.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The aim of this study is to test the feasibility and reproducibility of diffusion-weighted magnetic resonance imaging (DW-MRI) evaluations of the fetal brains in cases of twin-twin transfusion syndrome (TTTS). From May 2011 to June 2012, 24 patients with severe TTTS underwent MRI scans for evaluation of the fetal brains. Datasets were analyzed offline on axial DW images and apparent diffusion coefficient (ADC) maps by two radiologists. The subjective evaluation was described as the absence or presence of water diffusion restriction. The objective evaluation was performed by the placement of 20-mm(2) circular regions of interest on the DW image and ADC maps. Subjective interobserver agreement was assessed by the kappa correlation coefficient. Objective intraobserver and interobserver agreements were assessed by proportionate Bland-Altman tests. Seventy-four DW-MRI scans were performed. Sixty of them (81.1%) were considered to be of good quality. Agreement between the radiologists was 100% for the absence or presence of diffusion restriction of water. For both intraobserver and interobserver agreement of ADC measurements, proportionate Bland-Altman tests showed average percentage differences of less than 1.5% and 95% CI of less than 18% for all sites evaluated. Our data demonstrate that DW-MRI evaluation of the fetal brain in TTTS is feasible and reproducible.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The Atlantic rainforest species Ocotea catharinensis, Ocotea odorifera, and Ocotea porosa have been extensively harvested in the past for timber and oil extraction and are currently listed as threatened due to overexploitation. To investigate the genetic diversity and population structure of these species, we developed 8 polymorphic microsatellite markers for O. odorifera from an enriched microsatellite library by using 2 dinucleotide repeats. The microsatellite markers were tested for cross-amplification in O. catharinensis and O. porosa. The average number of alleles per locus was 10.2, considering all loci over 2 populations of O. odorifera. Observed and expected heterozygosities for O. odorifera ranged from 0.39 to 0.93 and 0.41 to 0.92 across populations, respectively. Cross-amplification of all loci was successfully observed in O. catharinensis and O. porosa except 1 locus that was found to lack polymorphism in O. porosa. Combined probabilities of identity in the studied Ocotea species were very low ranging from 1.0 x 10-24 to 7.7 x 10-24. The probability of exclusion over all loci estimated for O. odorifera indicated a 99.9% chance of correctly excluding a random nonparent individual. The microsatellite markers described in this study have high information content and will be useful for further investigations on genetic diversity within these species and for subsequent conservation purposes.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The aim of this study was to evaluate the mutagenicity (clastogenicity/aneugenicity) of a glycolic extract of Ziziphus joazeiro bark (GEZJ) by the micronucleus assay in mice bone marrow. Antimutagenic activity was also assessed using treatments associated with GEZJ and doxorubicin (DXR). Mice were evaluated 24-48 h after exposure to positive (N-nitroso-N-ethylurea, NEU - 50 mg.kg(-1) and DXR - 5 mg.kg(-1)) and negative (150 mM NaCl) controls, as well as treatment with GEZJ (0.5-2 g.kg(-1)), GEZJ (2 g.kg(-1)) + NEU and GEZJ (2 g.kg(-1)) + DXR. There were no significant differences in the frequencies of micronucleated polychromatic erythrocytes in mice treated with GEJZ and GEJZ + DXR compared to the negative controls, indicating that GEZJ was not mutagenic. Analysis of the polychromatic:normochromatic erythrocyte ratio revealed significant differences in the responses to doses of 0.5 g.kg(-1) and 1-2 g.kg(-1) and the positive control (NEU). These results indicated no systemic toxicity and moderate toxicity at lower and higher doses of GEZJ. The lack of mutagenicity and systemic toxicity in the antimutagenic assays, especially for treatment with GEZJ + DXR, suggested that phytochemical compounds in Z. joazeiro bark attenuated DXR-induced mutagenicity and the moderate systemic toxicity of a high dose of Z. joazeiro bark (2 g.kg(-1)). Further studies on the genotoxicity of Z. joazeiro extracts are necessary to establish the possible health risk in humans and to determine the potential as a chemopreventive agent for therapeutic use.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Last instar larvae and pupae of Ourocnemis archytas (Lepidoptera: Riodinidae) are described for the first time and compared with those of Anteros formosus, which are also described in detail. Last instars of both species present body covered with long white plumose setae, a row of orange balloon setae on the prothoracic shield, and clusters of perforated cupola organs (PCOs) near the spiracles; differences are the black cephalic capsule, the placement and format of balloon setae cluster, and the presence of enlarged black tips on some plumose setae. Pupae of O. archytas resemble that of Anteros, covered with the last instar setae and with no balloon setae. Characteristics of the immature stages of these two genera could be useful to establish the still unresolved relationship between them. A summary of the host plants of Helicopini is presented, showing a polyphagous pattern for Anteros, recorded in 21 host plant families, which contrasts with the specialized diet observed in Helicopis and Sarota. 

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Avian pathogenic Escherichia coli (APEC) strains belong to a category that is associated with colibacillosis, a serious illness in the poultry industry worldwide. Additionally, some APEC groups have recently been described as potential zoonotic agents. In this work, we compared APEC strains with extraintestinal pathogenic E. coli (ExPEC) strains isolated from clinical cases of humans with extra-intestinal diseases such as urinary tract infections (UTI) and bacteremia. PCR results showed that genes usually found in the ColV plasmid (tsh, iucA, iss, and hlyF) were associated with APEC strains while fyuA, irp-2, fepC sitDchrom, fimH, crl, csgA, afa, iha, sat, hlyA, hra, cnf1, kpsMTII, clpVSakai and malX were associated with human ExPEC. Both categories shared nine serogroups (O2, O6, O7, O8, O11, O19, O25, O73 and O153) and seven sequence types (ST10, ST88, ST93, ST117, ST131, ST155, ST359, ST648 and ST1011). Interestingly, ST95, which is associated with the zoonotic potential of APEC and is spread in avian E. coli of North America and Europe, was not detected among 76 APEC strains. When the strains were clustered based on the presence of virulence genes, most ExPEC strains (71.7%) were contained in one cluster while most APEC strains (63.2%) segregated to another. In general, the strains showed distinct genetic and fingerprint patterns, but avian and human strains of ST359, or ST23 clonal complex (CC), presented more than 70% of similarity by PFGE. The results demonstrate that some zoonotic-related STs (ST117, ST131, ST10CC, ST23CC) are present in Brazil. Also, the presence of moderate fingerprint similarities between ST359 E. coli of avian and human origin indicates that strains of this ST are candidates for having zoonotic potential.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Tabebuia cassinoides (Lam.) DC., popularly known as caxeta, is a tree species that belongs to the plant family Bignoniaceae. This species is endemic to the Brazilian Atlantic Forest and is widely exploited commercially. To date, little is known about its genetic structure, preventing the establishment of adequate management plans for this taxon. The objective of this study was to construct a microsatellite-enriched genomic library for T. cassinoides to select polymorphic loci, and standardize polymerase chain reaction amplification conditions. Of the 15 loci examined, 5 were polymorphic. The number of alleles per locus ranged from 2 to 8, with a mean of 4.4. The microsatellite loci described here represent the basis for detailed population genetic studies of this species, which will greatly contribute for the development of better conservation strategies for this taxon.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

A pterosaur bone bed with at least 47 individuals (wing spans: 0.65-2.35 m) of a new species is reported from southern Brazil from an interdunal lake deposit of a Cretaceous desert, shedding new light on several biological aspects of those flying reptiles. The material represents a new pterosaur, Caiuajara dobruskii gen. et sp. nov., that is the southermost occurrence of the edentulous clade Tapejaridae (Tapejarinae, Pterodactyloidea) recovered so far. Caiuajara dobruskii differs from all other members of this clade in several cranial features, including the presence of a ventral sagittal bony expansion projected inside the nasoantorbital fenestra, which is formed by the premaxillae; and features of the lower jaw, like a marked rounded depression in the occlusal concavity of the dentary. Ontogenetic variation of Caiuajara dobruskii is mainly reflected in the size and inclination of the premaxillary crest, changing from small and inclined (∼ 115°) in juveniles to large and steep (∼ 90°) in adults. No particular ontogenetic features are observed in postcranial elements. The available information suggests that this species was gregarious, living in colonies, and most likely precocial, being able to fly at a very young age, which might have been a general trend for at least derived pterosaurs.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

This study sought to evaluate the association between the impact of oral disorders in terms of physical/psychosocial dimensions and quality of life among the elderly. It involved a cross-sectional study conducted among the elderly (65-74 years) in 2008/2009. The social impact was assessed using the Oral Health Impact Profile (OHIP 14) and the quality of life using the SF 12 Short-Form Health Survey. Descriptive, univariate and multivariate (logistic regression) analysis was conducted with correction for the design effect, using SPSS(r)18.0 software. Of the 800 individuals approached, 736 elderly individuals participated (TR = 92%), with a mean age of 67.77 years, the majority of whom showed no impact based on the measurement of the prevalence of OHIP. The functional limitation dimension of the OHIP was associated with the physical domain of the SF12, irrespective of the other variables investigated. However, the seriousness of OHIP and its psychological discomfort and disability dimensions was associated with the mental domain of the SF12. The conclusion reached is that some impacts of oral disorders were associated with unsatisfactory quality of life in the physical and mental domains.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

To evaluate the correlation between neck circumference and insulin resistance and components of metabolic syndrome in adolescents with different adiposity levels and pubertal stages, as well as to determine the usefulness of neck circumference to predict insulin resistance in adolescents. Cross-sectional study with 388 adolescents of both genders from ten to 19 years old. The adolescents underwent anthropometric and body composition assessment, including neck and waist circumferences, and biochemical evaluation. The pubertal stage was obtained by self-assessment, and the blood pressure, by auscultation. Insulin resistance was evaluated by the Homeostasis Model Assessment-Insulin Resistance. The correlation between two variables was evaluated by partial correlation coefficient adjusted for the percentage of body fat and pubertal stage. The performance of neck circumference to identify insulin resistance was tested by Receiver Operating Characteristic Curve. After the adjustment for percentage body fat and pubertal stage, neck circumference correlated with waist circumference, blood pressure, triglycerides and markers of insulin resistance in both genders. The results showed that the neck circumference is a useful tool for the detection of insulin resistance and changes in the indicators of metabolic syndrome in adolescents. The easiness of application and low cost of this measure may allow its use in Public Health services.