9 resultados para Germanías, 1519-1523
em Repositório da Produção Científica e Intelectual da Unicamp
Resumo:
We describe herein a general method for the controlled Heck arylation of allylated malonates. Both electron-rich and electron-poor aryldiazonium salts were readily employed as the aryl-transfer agents in good yields and in high chemo-, regio-, and stereoselectivity without formation of decarboxylated byproducts. Reaction monitoring via ESI-MS was used to support the formation of chelated Pd species through the catalytic cycle. Additionally, some Heck adducts were successfully used in the total synthesis of pharmacologically active γ-lactones.
Resumo:
The 2005 National Institutes of Health (NIH) Consensus Conference proposed new criteria for diagnosing and scoring the severity of chronic graft-versus-host disease (GVHD). The 2014 NIH consensus maintains the framework of the prior consensus with further refinement based on new evidence. Revisions have been made to address areas of controversy or confusion, such as the overlap chronic GVHD subcategory and the distinction between active disease and past tissue damage. Diagnostic criteria for involvement of mouth, eyes, genitalia, and lungs have been revised. Categories of chronic GVHD should be defined in ways that indicate prognosis, guide treatment, and define eligibility for clinical trials. Revisions have been made to focus attention on the causes of organ-specific abnormalities. Attribution of organ-specific abnormalities to chronic GVHD has been addressed. This paradigm shift provides greater specificity and more accurately measures the global burden of disease attributed to GVHD, and it will facilitate biomarker association studies.
Resumo:
The main aim of this investigation was to verify the relationship of the variables measured during a 3-minute all-out test with aerobic (i.e., peak oxygen uptake [(Equation is included in full-text article.)] and intensity corresponding to the lactate minimum [LMI]) and anaerobic parameters (i.e., anaerobic work) measured during a 400-m maximal performance. To measure force continually and to avoid the possible influences caused by turns, the 3-minute all-out effort was performed in tethered swimming. Thirty swimmers performed the following tests: (a) a 3-minute all-out tethered swimming test to determine the final force (equivalent to critical force: CF3-MIN) and the work performed above CF3-MIN (W'3-MIN), (b) a LMI protocol to determine the LMI during front crawl swimming, and (c) a 400-m maximal test to determine the (Equation is included in full-text article.)and total anaerobic contribution (WANA). Correlations between the variables were tested using the Pearson's correlation test (p ≤ 0.05). CF3-MIN (73.9 ± 13.2 N) presented a high correlation with the LMI (1.33 ± 0.08 m·s; p = 0.01) and (Equation is included in full-text article.)(4.5 ± 1.2 L·min; p = 0.01). However, the W'3-MIN (1,943.2 ± 719.2 N·s) was only moderately correlated with LMI (p = 0.02) and (Equation is included in full-text article.)(p = 0.01). In summary, CF3-MIN determined during the 3-minute all-out effort is associated with oxidative metabolism and can be used to estimate the aerobic capacity of swimmers. In contrast, the anaerobic component of this model (W'3-MIN) is not correlated with WANA.
Resumo:
Prey size is an important factor in food consumption. In studies of feeding ecology, prey items are usually measured individually using calipers or ocular micrometers. Among amphibians and reptiles, there are species that feed on large numbers of small prey items (e.g. ants, termites). This high intake makes it difficult to estimate prey size consumed by these animals. We addressed this problem by developing and evaluating a procedure for subsampling the stomach contents of such predators in order to estimate prey size. Specifically, we developed a protocol based on a bootstrap procedure to obtain a subsample with a precision error of at the most 5%, with a confidence level of at least 95%. This guideline should reduce the sampling effort and facilitate future studies on the feeding habits of amphibians and reptiles, and also provide a means of obtaining precise estimates of prey size.
Resumo:
The behaviour of the albino and melanic variants of Biomphalaria glabrata of Belo Horizonte (MG. Brazil) was studied comparatively, in terms of their respective susceptibilities to infection by Schistosoma mansoni of the same origin, through observation of the elimination of cercariae for a three-month period and the calculation of mortality and infection rates, in control and in infected snails. The number of amoebocytes, granulocytes and hyalinocytes in the circulating hemolymph during different periods of infection was analyzed. The evolution of the infection in the tissues was observed by means of histological cross-sections. The melanic variant showed greater susceptibility to infection and a higher mortality rate. The albino variant showed a higher number of circulating amoebocytes, both granulocytes and hyalinocytes. A higher number of degenerated sporocysts were seen in the histological cross-sections of the albino variant. The results suggest that the melanic variant of B. glabrata was more susceptible to infection by S. mansoni than was the albino variant.
Resumo:
This work investigated the cytotoxic and genotoxic potential of water from the River Paraíba do Sul (Brazil) using Allium cepa roots. An anatomo-morphological parameter (root length), mitotic indices, and frequency of micronuclei were analysed. Eight bulbs were chosen at random for treatment for 24 to 120 hours with the River water collected in the years of 2005 and 2006 from sites in the cities of Tremembé and Aparecida (São Paulo state, Brazil). Daily measurements of the length of the roots grown from each bulb were carried out throughout the experiment. Mitotic index (MI) and frequency of micronuclei (MN) were determined for 2000 cells per root, using 3-5 root tips from other bulbs (7-10). Only in the roots treated with samples of the River water collected in 2005 in Tremembé city was there a decrease in the root length growth compared to the respective control. However, a reduction in MI values was verified for both sites analysed for that year. Considering the data involving root length growth and especially MI values, a cytotoxic potential is suggested for the water of the River Paraíba do Sul at Tremembé and Aparecida, in the year of 2005. On the other hand, since in this year the MN frequency was not affected with the river water treatments, genotoxicity is not assumed for the river water sampled at the aforementioned places.
Resumo:
Food habits of jaguarundi (Puma yagouaroundi) (Geoffroy, 1803) (Carnivora, Felidae) were studied between November 2000 and November 2001, in a 24.9 km² area of secondary Atlantic Rainforest and eucalypt plantation, in the Serra de Paranapiacaba, São Paulo State, Brazil. Analyses of 26 fecal and regurgitate samples, obtained over a stretch of 570.1 km, showed the consumption of 19 prey items and 74 prey occurrences. Small mammals were the most frequent food item (42.5%), followed by birds (21%), reptiles (14%) and medium-sized mammals (3%). The percent occurrence (PO) suggests that the diet consisted mainly of small rodents (30%) and birds (21%). We recorded for the first time the predation of Viperidae snakes by P. yagouaroundi. Although having a large list of items and range of dietary niche breadths (Bsta = 0.76), our data show that jaguarundi prey mainly on small vertebrates (mammals, birds or reptiles), and even in tall tropical forests or eucalypt plantations, it preys mostly on animals that come to, or live on, the ground.
Resumo:
A new species of dactylogyrid monogenean, Apedunculata discoidea gen. n., sp. n. is described and illustrated from the gills of the freshwater fish Prochilodus lineatus (Valenciennes, 1837) in pisciculture ponds from Pirassununga, São Paulo, Brazil. Diagnostic characters of the new genus and species are: 1) vagina dextrolateral slightly sclerotised, opening anteriorly at level of copulatory complex; 2) copulatory organ coiled with two counterclockwise rings; 3) Accessory piece distal and not articulated; 4) body disk-shaped, lacking a peduncle.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.