19 resultados para Fumée entière de cigarette
em Repositório da Produção Científica e Intelectual da Unicamp
Resumo:
To evaluate associations between polymorphisms of the N-acetyltransferase 2 (NAT2), human 8-oxoguanine glycosylase 1 (hOGG1) and X-ray repair cross-complementing protein 1 (XRCC1) genes and risk of upper aerodigestive tract (UADT) cancer. A case-control study involving 117 cases and 224 controls was undertaken. The NAT2 gene polymorphisms were genotyped by automated sequencing and XRCC1 Arg399Gln and hOGG1 Ser326Cys polymorphisms were determined by Polymerase Chain Reaction followed by Restriction Fragment Length Polymorphism (PCR-RFLP) methods. Slow metabolization phenotype was significantly associated as a risk factor for the development of UADT cancer (p=0.038). Furthermore, haplotype of slow metabolization was also associated with UADT cancer (p=0.014). The hOGG1 Ser326Cys polymorphism (CG or GG vs. CC genotypes) was shown as a protective factor against UADT cancer in moderate smokers (p=0.031). The XRCC1 Arg399Gln polymorphism (GA or AA vs. GG genotypes), in turn, was a protective factor against UADT cancer only among never-drinkers (p=0.048). Interactions involving NAT2, XRCC1 Arg399Gln and hOGG1 Ser326Cys polymorphisms may modulate the risk of UADT cancer in this population.
Resumo:
Hypothalamic inflammation is a common feature of experimental obesity. Dietary fats are important triggers of this process, inducing the activation of toll-like receptor-4 (TLR4) signaling and endoplasmic reticulum stress. Microglia cells, which are the cellular components of the innate immune system in the brain, are expected to play a role in the early activation of diet-induced hypothalamic inflammation. Here, we use bone marrow transplants to generate mice chimeras that express a functional TLR4 in the entire body except in bone marrow-derived cells or only in bone marrow-derived cells. We show that a functional TLR4 in bone marrow-derived cells is required for the complete expression of the diet-induced obese phenotype and for the perpetuation of inflammation in the hypothalamus. In an obesity-prone mouse strain, the chemokine CX3CL1 (fractalkine) is rapidly induced in the neurons of the hypothalamus after the introduction of a high-fat diet. The inhibition of hypothalamic fractalkine reduces diet-induced hypothalamic inflammation and the recruitment of bone marrow-derived monocytic cells to the hypothalamus; in addition, this inhibition reduces obesity and protects against diet-induced glucose intolerance. Thus, fractalkine is an important player in the early induction of diet-induced hypothalamic inflammation, and its inhibition impairs the induction of the obese and glucose intolerance phenotypes.
Resumo:
The Centers for High Cost Medication (Centros de Medicação de Alto Custo, CEDMAC), Health Department, São Paulo were instituted by project in partnership with the Clinical Hospital of the Faculty of Medicine, USP, sponsored by the Foundation for Research Support of the State of São Paulo (Fundação de Amparo à Pesquisa do Estado de São Paulo, FAPESP) aimed at the formation of a statewide network for comprehensive care of patients referred for use of immunobiological agents in rheumatological diseases. The CEDMAC of Hospital de Clínicas, Universidade Estadual de Campinas (HC-Unicamp), implemented by the Division of Rheumatology, Faculty of Medical Sciences, identified the need for standardization of the multidisciplinary team conducts, in face of the specificity of care conducts, verifying the importance of describing, in manual format, their operational and technical processes. The aim of this study is to present the methodology applied to the elaboration of the CEDMAC/HC-Unicamp Manual as an institutional tool, with the aim of offering the best assistance and administrative quality. In the methodology for preparing the manuals at HC-Unicamp since 2008, the premise was to obtain a document that is participatory, multidisciplinary, focused on work processes integrated with institutional rules, with objective and didactic descriptions, in a standardized format and with electronic dissemination. The CEDMAC/HC-Unicamp Manual was elaborated in 10 months, with involvement of the entire multidisciplinary team, with 19 chapters on work processes and techniques, in addition to those concerning the organizational structure and its annexes. Published in the electronic portal of HC Manuals in July 2012 as an e-Book (ISBN 978-85-63274-17-5), the manual has been a valuable instrument in guiding professionals in healthcare, teaching and research activities.
Resumo:
The overall prevalence of infertility was estimated to be 3.5-16.7% in developing countries and 6.9-9.3% in developed countries. Furthermore, according to reports from some regions of sub-Saharan Africa, the prevalence rate is 30-40%. The consequences of infertility and how it affects the lives of women in poor-resource settings, particularly in developing countries, has become an important issue to be discussed in reproductive health. In some societies, the inability to fulfill the desire to have children makes life difficult for the infertile couple. In many regions, infertility is considered a tragedy that affects not only the infertile couple or woman, but the entire family. This is a position paper which encompasses a review of the needs of low-income infertile couples, mainly those living in developing countries, regarding access to infertility care, including ART and initiatives to provide ART at low or affordable cost. Information was gathered from the databases MEDLINE, CENTRAL, POPLINE, EMBASE, LILACS, and ICTRP with the key words: infertility, low income, assisted reproductive technologies, affordable cost, low cost. There are few initiatives geared toward implementing ART procedures at low cost or at least at affordable cost in low-income populations. Nevertheless, from recent studies, possibilities have emerged for new low-cost initiatives that can help millions of couples to achieve the desire of having a biological child. It is necessary for healthcare professionals and policymakers to take into account these new initiatives in order to implement ART in resource-constrained settings.
Resumo:
A Bacillus cereus strain, FT9, isolated from a hot spring in the midwest region of Brazil, had its entire genome sequenced.
Resumo:
American tegumentary leishmaniasis (ATL) is a disease transmitted to humans by the female sandflies of the genus Lutzomyia. Several factors are involved in the disease transmission cycle. In this work only rainfall and deforestation were considered to assess the variability in the incidence of ATL. In order to reach this goal, monthly recorded data of the incidence of ATL in Orán, Salta, Argentina, were used, in the period 1985-2007. The square root of the relative incidence of ATL and the corresponding variance were formulated as time series, and these data were smoothed by moving averages of 12 and 24 months, respectively. The same procedure was applied to the rainfall data. Typical months, which are April, August, and December, were found and allowed us to describe the dynamical behavior of ATL outbreaks. These results were tested at 95% confidence level. We concluded that the variability of rainfall would not be enough to justify the epidemic outbreaks of ATL in the period 1997-2000, but it consistently explains the situation observed in the years 2002 and 2004. Deforestation activities occurred in this region could explain epidemic peaks observed in both years and also during the entire time of observation except in 2005-2007.
Resumo:
Iranian propolis is a natural product of honeybees that has significant and varied anti-cancer benefits. The present study was designed to investigate the protective effects of Iranian propolis on gastric tissue carcinogenesis in an animal model. Propolis samples were collected from Hamadan and Taleghan districts of Iran, followed by ultra performance liquid chromatography mass spectrometry analysis. Fifty-five rats were divided into three groups; control, Taleghan propolis and Hamadan propolis. All the animals received N-methyl-N-nitro-N-nitrosoguanidine (MNNG, 100 μg/ml) in drinking water ad libitum for 34 weeks. In the treated groups, nutrition with propolis was started two weeks before MNNG administration. At the end of the study, the entire gastrointestinal tract was scrutinized for tumors, and the rest of the body was assessed for metastatic deposits. Results indicated that the incidence and number of tumors were significantly decreased by propolis in comparison with the control group (P < 0.05). The nuclear/cytoplasmic ratio, epithelial stratification, nuclear dispolarity, structural abnormality, and Beta-catenin and Bcl-2 proteins expression were significantly reduced in the propolis group compared to the control group (P < 0.05). In addition, Bax protein expression was significantly increased in the propolis group in comparison with the control group (P < 0.05). The present study demonstrated the potential chemoprotective effects of the Iranian propolis against gastric cancer in a typical animal model. The results provide evidence for the hypothesis that Iranian propolis may exert a chemoprotective effect on MNNG-initiated gastric cancer through inhibition of cell proliferation and apoptosis induction.
Resumo:
To evaluate pathologic features with implications on surgical radicality in women treated with radical hysterectomy and pelvic lymphadenectomy for cervical cancer stage IA1 with lymph vascular space invasion (LVSI) and stage IA2 by correlating findings in conization and hysterectomy specimens. Women with cervical cancer stage IA1 with LVSI and stage IA2 diagnosed by loop electrosurgical excisional procedure or cold knife conization were treated with radical hysterectomy and pelvic lymphadenectomy from January 1999 to December 2011 in 2 institutions. Fifty patients were enrolled: 40 with stage IA2 and 10 with stage IA1 with LVSI. Median age was 43 (30-67) years. All patients underwent cervical conization for diagnosis (45 loop electrosurgical excisional procedure, 5 cold knife). Lymph vascular space invasion was detected in 15 patients (30%). Two patients had positive pelvic nodes. No parametrial involvement was detected in the entire cohort. Positive margins were present in 35 patients, and residual disease was detected in 22 patients (44%). Positive margins predicted residual disease at radical hysterectomy (P = 0.02). Medium follow-up time was 51 months. One patient developed a pelvic recurrence, and there were no disease-related deaths. Patients with positive margins in cone biopsy specimens have an increased risk of residual disease at radical hysterectomy and require careful evaluation before conservative surgery. Pelvic lymph node evaluation is essential because lymph node metastasis may occur even in early stages. The lack of parametrial invasion in this study reinforces the knowledge that the select group of patients with microinvasive cervical carcinoma stages IA1 LVSI and stage IA2 have a very low risk of parametrial infiltration. Less radical surgery can be carefully considered for these patients.
Resumo:
Seasonally dry tropical plant formations (SDTF) are likely to exhibit phylogenetic clustering owing to niche conservatism driven by a strong environmental filter (water stress), but heterogeneous edaphic environments and life histories may result in heterogeneity in degree of phylogenetic clustering. We investigated phylogenetic patterns across ecological gradients related to water availability (edaphic environment and climate) in the Caatinga, a SDTF in Brazil. Caatinga is characterized by semiarid climate and three distinct edaphic environments - sedimentary, crystalline, and inselberg -representing a decreasing gradient in soil water availability. We used two measures of phylogenetic diversity: Net Relatedness Index based on the entire phylogeny among species present in a site, reflecting long-term diversification; and Nearest Taxon Index based on the tips of the phylogeny, reflecting more recent diversification. We also evaluated woody species in contrast to herbaceous species. The main climatic variable influencing phylogenetic pattern was precipitation in the driest quarter, particularly for herbaceous species, suggesting that environmental filtering related to minimal periods of precipitation is an important driver of Caatinga biodiversity, as one might expect for a SDTF. Woody species tended to show phylogenetic clustering whereas herbaceous species tended towards phylogenetic overdispersion. We also found phylogenetic clustering in two edaphic environments (sedimentary and crystalline) in contrast to phylogenetic overdispersion in the third (inselberg). We conclude that while niche conservatism is evident in phylogenetic clustering in the Caatinga, this is not a universal pattern likely due to heterogeneity in the degree of realized environmental filtering across edaphic environments. Thus, SDTF, in spite of a strong shared environmental filter, are potentially heterogeneous in phylogenetic structuring. Our results support the need for scientifically informed conservation strategies in the Caatinga and other SDTF regions that have not previously been prioritized for conservation in order to take into account this heterogeneity.
Resumo:
The objective of this study was to analyze changes in the spectral behavior of the soybean crop through spectral profiles of the vegetation indexes NDVI and GVI, expressed by different physical values such as apparent bi-directional reflectance factor (BRF), surface BRF, and normalized BRF derived from images of the Landsat 5/TM. A soybean area located in Cascavel, Paraná, was monitored by using five images of Landsat 5/TM during the 2004/2005 harvesting season. The images were submitted to radiometric transformation, atmospheric correction and normalization, determining physical values of apparent BRF, surface BRF and normalized BRF. NDVI and GVI images were generated in order to distinguish the soybean biomass spectral response. The treatments showed different results for apparent, surface and normalized BRF. Through the profiles of average NDVI and GVI, it was possible to monitor the entire soybean cycle, characterizing its development. It was also observed that the data from normalized BRF negatively affected the spectral curve of soybean crop, mainly, during the phase of vegetative growth, in the 12-9-2004 image.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física