Developmental Rate Of Immatures Of Two Fly Species Of Forensic Importance: Sarcophaga (liopygia) Ruficornis And Microcerella Halli (diptera: Sarcophagidae).

Since insect species are poikilothermic organisms, they generally exhibit different growth patterns depending on the temperature at which they develop. This factor is important in forensic entomology, especially for estimating postmortem interval (PMI) when it is based on the developmental time of the insects reared in decomposing bodies. This study aimed to estimate the rates of development, viability, and survival of immatures of Sarcophaga (Liopygia) ruficornis (Fabricius 1794) and Microcerella halli (Engel 1931) (Diptera: Sarcophagidae) reared in different temperatures: 10, 15, 20, 25, 30, and 35 ± 1 °C. Bovine raw ground meat was offered as food for all experimental groups, each consisting of four replicates, in the proportion of 2 g/larva. To measure the evolution of growth, ten specimens of each group were randomly chosen and weighed every 12 h, from initial feeding larva to pupae, and then discarded. Considering the records of weight gain, survival rates, and stability of growth rates, the range of optimum temperature for the development of S. (L.) ruficornis is between 20 and 35 °C, and that of M. halli is between 20 and 25 °C. For both species, the longest times of development were in the lowest temperatures. The survival rate at extreme temperatures (10 and 35 °C) was lower in both species. Biological data such as the ones obtained in this study are of great importance to achieve a more accurate estimate of the PMI.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Silk Fibroin And Sodium Alginate Blend: Miscibility And Physical Characteristics.

Films of silk fibroin (SF) and sodium alginate (SA) blends were prepared by solution casting technique. The miscibility of SF and SA in those blends was evaluated and scanning electron microscopy (SEM) revealed that SF/SA 25/75 wt.% blends underwent microscopic phase separation, resulting in globular structures composed mainly of SF. X-ray diffraction indicated the amorphous nature of these blends, even after a treatment with ethanol that turned them insoluble in water. Thermal analyses of blends showed the peaks of degradation of pristine SF and SA shifted to intermediate temperatures. Water vapor permeability, swelling capacity and tensile strength of SF films could be enhanced by blending with SA. Cell viability remained between 90 and 100%, as indicated by in vitro cytotoxicity test. The SF/SA blend with self-assembled SF globules can be used to modulate structural and mechanical properties of the final material and may be used in designing high performance wound dressing.

Discovery Of A Rare Pterosaur Bone Bed In A Cretaceous Desert With Insights On Ontogeny And Behavior Of Flying Reptiles.

A pterosaur bone bed with at least 47 individuals (wing spans: 0.65-2.35 m) of a new species is reported from southern Brazil from an interdunal lake deposit of a Cretaceous desert, shedding new light on several biological aspects of those flying reptiles. The material represents a new pterosaur, Caiuajara dobruskii gen. et sp. nov., that is the southermost occurrence of the edentulous clade Tapejaridae (Tapejarinae, Pterodactyloidea) recovered so far. Caiuajara dobruskii differs from all other members of this clade in several cranial features, including the presence of a ventral sagittal bony expansion projected inside the nasoantorbital fenestra, which is formed by the premaxillae; and features of the lower jaw, like a marked rounded depression in the occlusal concavity of the dentary. Ontogenetic variation of Caiuajara dobruskii is mainly reflected in the size and inclination of the premaxillary crest, changing from small and inclined (∼ 115°) in juveniles to large and steep (∼ 90°) in adults. No particular ontogenetic features are observed in postcranial elements. The available information suggests that this species was gregarious, living in colonies, and most likely precocial, being able to fly at a very young age, which might have been a general trend for at least derived pterosaurs.

Nitric Oxide-releasing Poly(vinyl Alcohol) Film For Increasing Dermal Vasodilation.

Pathological conditions associated with the impairment of nitric oxide (NO) production in the vasculature, such as Raynaud's syndrome and diabetic angiopathy, have stimulated the development of new biomaterials capable of delivering NO topically. With this purpose, we modified poly(vinyl-alcohol) (PVA) by chemically crosslinking it via esterification with mercaptosuccinic acid. This reaction allowed the casting of sulfhydrylated PVA (PVA-SH) films. Differential scanning calorimetry and X-ray diffractometry showed that the crosslinking reaction completely suppressed the crystallization of PVA, leading to a non-porous film with a homogeneous distribution of -SH groups. The remaining free hydroxyl groups in the PVA-SH network conferred partial hydrophylicity to the material, which was responsible for a swelling degree of ca. 110%. The PVA-SH films were subjected to an S-nitrosation reaction of the -SH groups, yielding a PVA containing S-nitrosothiol groups (PVA-SNO). Amperometric and chemiluminescence measurements showed that the PVA-SNO films were capable of releasing NO spontaneously after immersion in physiological medium. Laser Doppler-flowmetry, used to assess the blood flow in the dermal microcirculation, showed that the topical application of hydrated PVA-SNO films on the health skin led to a dose- and time-dependent increase of more than 5-fold in the dermal baseline blood flow in less than 10min, with a prolonged action of more than 4h during continuous application. These results show that PVA-SNO films might emerge as a new material with potential for the topical treatment of microvascular skin disorders.

Caracterização físico-química de filmes comestíveis de amido adicionado de acerola (Malphigia emarginata D.C.)

Edibles films are an alternative to synthetic materials used for packing food products. Barbados cherry is rich in vitamin C and carotenoids. The aim of this study was to characterize and develop films by casting from cassava starch, lyophilized Barbados cherry pulp and glycerol. The films were characterized with respect to thickness, water vapor permeability (WVP), water solubility, vitamin C, carotene and mechanical properties. The interaction of pulp and glycerol reduced film thickness. An increase in pulp concentration up to 60% increased WVP but beyond this concentration reduced both WVP and solubility leading to an increased level of vitamin C and β carotene in the films.

Risco, corpo e socialidade no voo livre

Universidade Estadual de Campinas . Faculdade de Educação Física