Developmental Rate Of Immatures Of Two Fly Species Of Forensic Importance: Sarcophaga (liopygia) Ruficornis And Microcerella Halli (diptera: Sarcophagidae).

Since insect species are poikilothermic organisms, they generally exhibit different growth patterns depending on the temperature at which they develop. This factor is important in forensic entomology, especially for estimating postmortem interval (PMI) when it is based on the developmental time of the insects reared in decomposing bodies. This study aimed to estimate the rates of development, viability, and survival of immatures of Sarcophaga (Liopygia) ruficornis (Fabricius 1794) and Microcerella halli (Engel 1931) (Diptera: Sarcophagidae) reared in different temperatures: 10, 15, 20, 25, 30, and 35 ± 1 °C. Bovine raw ground meat was offered as food for all experimental groups, each consisting of four replicates, in the proportion of 2 g/larva. To measure the evolution of growth, ten specimens of each group were randomly chosen and weighed every 12 h, from initial feeding larva to pupae, and then discarded. Considering the records of weight gain, survival rates, and stability of growth rates, the range of optimum temperature for the development of S. (L.) ruficornis is between 20 and 35 °C, and that of M. halli is between 20 and 25 °C. For both species, the longest times of development were in the lowest temperatures. The survival rate at extreme temperatures (10 and 35 °C) was lower in both species. Biological data such as the ones obtained in this study are of great importance to achieve a more accurate estimate of the PMI.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Discovery Of A Rare Pterosaur Bone Bed In A Cretaceous Desert With Insights On Ontogeny And Behavior Of Flying Reptiles.

A pterosaur bone bed with at least 47 individuals (wing spans: 0.65-2.35 m) of a new species is reported from southern Brazil from an interdunal lake deposit of a Cretaceous desert, shedding new light on several biological aspects of those flying reptiles. The material represents a new pterosaur, Caiuajara dobruskii gen. et sp. nov., that is the southermost occurrence of the edentulous clade Tapejaridae (Tapejarinae, Pterodactyloidea) recovered so far. Caiuajara dobruskii differs from all other members of this clade in several cranial features, including the presence of a ventral sagittal bony expansion projected inside the nasoantorbital fenestra, which is formed by the premaxillae; and features of the lower jaw, like a marked rounded depression in the occlusal concavity of the dentary. Ontogenetic variation of Caiuajara dobruskii is mainly reflected in the size and inclination of the premaxillary crest, changing from small and inclined (∼ 115°) in juveniles to large and steep (∼ 90°) in adults. No particular ontogenetic features are observed in postcranial elements. The available information suggests that this species was gregarious, living in colonies, and most likely precocial, being able to fly at a very young age, which might have been a general trend for at least derived pterosaurs.

Auxin And Physical Constraint Exerted By The Perianth Promote Androgynophore Bending In Passiflora Mucronata L. (passifloraceae).

The androgynophore column, a distinctive floral feature in passion flowers, is strongly crooked or bent in many Passiflora species pollinated by bats. This is a floral feature that facilitates the adaptation to bat pollination. Crooking or bending of plant organs are generally caused by environmental stimulus (e.g. mechanical barriers) and might involve the differential distribution of auxin. Our aim was to study the role of the perianth organs and the effect of auxin in bending of the androgynophore of the bat-pollinated species Passiflora mucronata. Morpho-anatomical characterisation of the androgynophore, including measurements of curvature angles and cell sizes both at the dorsal (convex) and ventral (concave) sides of the androgynophore, was performed on control flowers, flowers from which perianth organs were partially removed and flowers treated either with auxin (2,4-dichlorophenoxyacetic acid; 2,4-D) or with an inhibitor of auxin polar transport (naphthylphthalamic acid; NPA). Asymmetric growth of the androgynophore column, leading to bending, occurs at a late stage of flower development. Removing the physical constraint exerted by perianth organs or treatment with NPA significantly reduced androgynophore bending. Additionally, the androgynophores of plants treated with 2,4-D were more curved when compared to controls. There was a larger cellular expansion at the dorsal side of the androgynophores of plants treated with 2,4-D and in both sides of the androgynophores of plants treated with NPA. This study suggests that the physical constraint exerted by perianth and auxin redistribution promotes androgynophore bending in P. mucronata and might be related to the evolution of chiropterophily in the genus Passiflora.

Semi-determinate Growth Habit Adjusts The Vegetative-to-reproductive Balance And Increases Productivity And Water-use Efficiency In Tomato (solanum Lycopersicum).

Tomato (Solanum lycopersicum) shows three growth habits: determinate, indeterminate and semi-determinate. These are controlled mainly by allelic variation in the SELF-PRUNING (SP) gene family, which also includes the florigen gene SINGLE FLOWER TRUSS (SFT). Determinate cultivars have synchronized flower and fruit production, which allows mechanical harvesting in the tomato processing industry, whereas indeterminate ones have more vegetative growth with continuous flower and fruit formation, being thus preferred for fresh market tomato production. The semi-determinate growth habit is poorly understood, although there are indications that it combines advantages of determinate and indeterminate growth. Here, we used near-isogenic lines (NILs) in the cultivar Micro-Tom (MT) with different growth habit to characterize semi-determinate growth and to determine its impact on developmental and productivity traits. We show that semi-determinate genotypes are equivalent to determinate ones with extended vegetative growth, which in turn impacts shoot height, number of leaves and either stem diameter or internode length. Semi-determinate plants also tend to increase the highly relevant agronomic parameter Brix×ripe yield (BRY). Water-use efficiency (WUE), evaluated either directly as dry mass produced per amount of water transpired or indirectly through C isotope discrimination, was higher in semi-determinate genotypes. We also provide evidence that the increases in BRY in semi-determinate genotypes are a consequence of an improved balance between vegetative and reproductive growth, a mechanism analogous to the conversion of the overly vegetative tall cereal varieties into well-balanced semi-dwarf ones used in the Green Revolution.

Pollination Ecology Of Two Species Of Elleanthus (orchidaceae): Novel Mechanisms And Underlying Adaptations To Hummingbird Pollination.

Relationships among floral biology, floral micromorphology and pollinator behaviour in bird-pollinated orchids are important issues to understand the evolution of the huge flower diversity within Orchidaceae. We aimed to investigate floral mechanisms underlying the interaction with pollinators in two hummingbird-pollinated orchids occurring in the Atlantic forest. We assessed floral biology, nectar traits, nectary and column micromorphologies, breeding systems and pollinators. In both species, nectar is secreted by lip calli through spaces between the medial lamellar surfaces of epidermal cells. Such form of floral nectar secretion has not been previously described. Both species present functional protandry and are self-compatible yet pollinator-dependent. Fruit sets in hand-pollination experiments were more than twice those under natural conditions, evidencing pollen limitation. The absence of fruit set in interspecific crosses suggests the existence of post-pollination barriers between these synchronopatric species. In Elleanthus brasiliensis, fruits resulting from cross-pollination and natural conditions were heavier than those resulting from self-pollination, suggesting advantages to cross-pollination. Hummingbirds pollinated both species, which share at least one pollinator species. Species differences in floral morphologies led to distinct pollination mechanisms. In E. brasiliensis, attachment of pollinaria to the hummingbird bill occurs through a lever apparatus formed by an appendage in the column, another novelty to the knowledge of orchids. In E. crinipes, pollinaria attachment occurs by simple contact with the bill during insertion into the flower tube, which fits tightly around the bill. The novelties described here illustrate the overlooked richness in ecology and morphophysiology in Orchidaceae. This article is protected by copyright. All rights reserved.

Nectar Robbery By A Hermit Hummingbird: Association To Floral Phenotype And Its Influence On Flowers And Network Structure.

Interactions between flowers and their visitors span the spectrum from mutualism to antagonism. The literature is rich in studies focusing on mutualism, but nectar robbery has mostly been investigated using phytocentric approaches focused on only a few plant species. To fill this gap, we studied the interactions between a nectar-robbing hermit hummingbird, Phaethornis ruber, and the array of flowers it visits. First, based on a literature review of the interactions involving  P. ruber, we characterized the association of floral larceny to floral phenotype. We then experimentally examined the effects of nectar robbing on nectar standing crop and number of visits of the pollinators to the flowers of Canna paniculata. Finally, we asked whether the incorporation of illegitimate interactions into the analysis affects plant-hummingbird network structure. We identified 97 plant species visited by P. ruber and found that P. ruber engaged in floral larceny in almost 30 % of these species. Nectar robbery was especially common in flowers with longer corolla. In terms of the effect on C. paniculata, the depletion of nectar due to robbery by P. ruber was associated with decreased visitation rates of legitimate pollinators. At the community level, the inclusion of the illegitimate visits of P. ruber resulted in modifications of how modules within the network were organized, notably giving rise to a new module consisting of P. ruber and mostly robbed flowers. However, although illegitimate visits constituted approximately 9 % of all interactions in the network, changes in nestedness, modularity, and network-level specialization were minor. Our results indicate that although a flower robber may have a strong effect on the pollination of a particular plant species, the inclusion of its illegitimate interactions has limited capacity to change overall network structure.

Levantamento e características ecológicas de orchidacea e da mata ciliar do rio dourados, Dourados-MS

The Orchidaceae is one of the largest flowering plants family and with a great importance to conservation. However, no survey on orchid flowers can be found in Mato Grosso do Sul. Thus, the objective of this work was to make a survey of the Orchidaceae species and of its ecology features in a riparian forest in a fragment of Floresta Estacional Semi-Decidual that belongs to the riparian forest of the Dourados River. The inventory was made by using a sweeping method for collection, and in addition to this the vertical and horizontal position of epiphytes were assessed on the hosts. For characterization of microclimate, it was used a thermohygrometer and luximeter. It was identified 17 species of 13 genera. Of the listed genera, the most abundant ones were: Acianthera, Macradenia and Capanemia. It was also noted a vertical and horizontal distribution of the Orchidaceae in relation to inverse gradient of water and light availability. Some species tended to be sensitive to height level categorization, whereas others seemed to occur with similar frequency along the host. In relation to the cardinal orientation, the apparent preferential response for south and east directions was associated to the low sampling effort and lower water availability, which could occur because the north face is opposed to the water body.

Florivory and sex ratio in Annona dioica St. Hil. (Annonaceae) in the Pantanal at Nhecolândia, southwestern Brazil

Annona dioica St. Hil. is a species that grows to approximately 2 m tall and is very widespread in the cerrados. Individual plants of this androdioecious species produce numerous hermaphroditic or male flowers, but few fruits. The aim of this study was to determine the sex ratio among the plants and to compare the frequency of herbivory between male and hermaphroditic flowers. The fieldwork was done by studying flowering plants in grasslands used as pasture for cattle at Fazenda Nhumirim. One hundred and forty-seven male plants and 71 hermaphroditic plants were examined and produced a total of 194 and 94 flowers, respectively, during the study period. The male:hermaphrodite sex ratio was 2.07:1, and was similar to the male:hermaphrodite flower ratio of 2.06:1. The frequency of florivory rate in hermaphrodites was significantly higher than in male flowers (33.0%, n = 31, and 25.7%, n = 50, respectively; G = 14.83; d.f. = 1; p < 0.001). The mean fresh weights of male and hermaphroditic flowers were significantly different (8.38 ± 2.40 g vs. 6.93 ± 2.68 g, respectively; 0 ± SEM; n = 50 each; t = 2.479; d.f. = 49; p = 0.017). These results indicate that the low fruit set in this species can be explained by the sex ratio, the greater herbivory of hermaphroditic flowers and the probable absence of pollinators.

Aspectos ultra-estruturais dos canais secretores em órgãos vegetativos e reprodutivos de Anacardiaceae

The study assessed phloem canal development and ultra-structure in shoot apices of Spondias dulcis G. Forst., phloematic canal ultra-structure in shoot apices of Tapirira guianensis Aubl., and floral canal ultra-structure and development and fruit canal ultra-structure of the latter specie. The flower and fruit canals of Anacardium humile St.Hil. were also studied ultra-structurally. The canals in shoot apices of S. dulcis show schizo-lysigenous formation and the floral canals of T. guianensis show schizogenous development. Epithelial cells of S. dulcis and T. guianensis canals have rough endoplasmic reticulum, free ribosomes, elongated plastids of several shapes with osmiophilic inclusions and dictyosomes with production of vesicles. Such organelles participate in the secretion of a heterogeneous exudate, which is comprised of hydrophilic and lipophilic substances. The epithelial cells of the fruit of A. humile present elongated plastids with circular membrane system, which are involved in the synthesis of lipophilic substances. The results of the ultra-structural analyses of the epithelial cells corroborate the results previously obtained in a histochemical study. In the histochemical study, lipophilic and hydrophilic substances were identified in the canals of T. guinanensis and S. dulcis and only lipophilic substances were identified in the canals of A. humile. Based on the ultrastructural aspects of the secretory canals of T. guianensis and S. dulcis we concluded that the plastids of the epithelial cells of the two species are different although they produce secretion of similar composition. A new record for the family is the presence of a great number of circular plastids in epithelial cells of the fruit of Anacardium humile. The pattern found in the secretory canals of the studied species is the ecrine type of secretion release.

Inibidor da ação do etileno na conservação pós-colheita de Chrysanthemum morifolium Ramat cv. Dragon

The durability and postharvest quality of cut flowers are fundamental attributes in value along the production chain and in consumer satisfaction. The objective of this study was to evaluate the effect of chemical inhibitors of ethylene action on maintaining the postharvest quality of chrysanthemum stems (Chrysanthemum morifolium Ramat cv. Dragon). The experiment tested maintenance solutions with silver thiosulfate (STS) under five levels (distilled water, a 0.2 mM STS, the STS 0.2 mM + sucrose at 50 g L-1, STS at 0.4 mM; STS at 0.4 mM + sucrose at 50 g L-1), and date of sampling, for three levels (0, 3, 6 days). Three replications with two flower stems in each treatment were used in the experiment. Physical assessments were made: color, fresh mass and relative water content; chemical evaluations: reducing sugars and pigments, and qualitative assessments: turgidity, flower color, and number of buds, open flowers and partially open flowers. Treatment with 0.2 mM STS resulted in better maintenance of fresh mass of stems. The concentration of pigments and reducing sugar was higher in those treatments in which sucrose was associated. The color and relative water content were favored in treatments STS 0.2 mM and 0.4 mM. The concentration of 0.2 mM STS obtained the best results, prolonging the vase life the stems. The quality of these stems was higher, with the best assessments of water content, color and turgidity.

Soluções de manutenção na pós-colheita de Chrysanthemum morifolium cv. Dragon

The development and use of techniques that extend the life vase of the flowers, maintaining the quality of the product, is essential for reducing postharvest losses. The objective of this work was to evaluate different solutions for maintenance, associated or not to sucrose, in maintaining the postharvest quality of chrysanthemum stems. The treatments used distilled water, 8-HQC to 100 mg L-1, 8-HQC to 100 mg L-1 + sucrose 50 g L-1, 8-HQC to 200 mg L-1, 8-HQC to 200 mg L-1 + sucrose 50 g L-1. Physical assessments were made: color, fresh mass and relative water content; chemical evaluations: reducing sugars and pigments, and qualitative assessments: turgidity, color of the flowers, and number of buttons, open flowers and partially open flowers. The combination of 8-HQC 200 mg L-1 + sucrose 50 g L-1 was the best performance that made for maintaining the quality of flower stems, favoring the opening of buttons and turgidity of petals. Sucrose contributed to better maintenance of the reserve substances in the shaft, which had increased the flower vase life.

Risco, corpo e socialidade no voo livre

Universidade Estadual de Campinas . Faculdade de Educação Física