5 resultados para Fishes -- Histology
em Repositório da Produção Científica e Intelectual da Unicamp
Resumo:
The objectives of the study were to evaluate the performance of sentinel lymph node biopsy (SLNB) in detecting occult metastases in papillary thyroid carcinoma (PTC) and to correlate their presence to tumor and patient characteristics. Twenty-three clinically node-negative PTC patients (21 females, mean age 48.4 years) were prospectively enrolled. Patients were submitted to sentinel lymph node (SLN) lymphoscintigraphy prior to total thyroidectomy. Ultrasound-guided peritumoral injections of (99m)Tc-phytate (7.4 MBq) were performed. Cervical single-photon emission computed tomography and computed tomography (SPECT/CT) images were acquired 15 min after radiotracer injection and 2 h prior to surgery. Intra-operatively, SLNs were located with a gamma probe and removed along with non-SLNs located in the same neck compartment. Papillary thyroid carcinoma, SLNs and non-SLNs were submitted to histopathology analysis. Sentinel lymph nodes were located in levels: II in 34.7 % of patients; III in 26 %; IV in 30.4 %; V in 4.3 %; VI in 82.6 % and VII in 4.3 %. Metastases in the SLN were noted in seven patients (30.4 %), in non-SLN in three patients (13.1 %), and in the lateral compartments in 20 % of patients. There were significant associations between lymph node (LN) metastases and the presence of angio-lymphatic invasion (p = 0.04), extra-thyroid extension (p = 0.03) and tumor size (p = 0.003). No correlations were noted among LN metastases and patient age, gender, stimulated thyroglobulin levels, positive surgical margins, aggressive histology and multifocal lesions. Sentinel lymph node biopsy can detect occult metastases in PTC. The risk of a metastatic SLN was associated with extra-thyroid extension, larger tumors and angio-lymphatic invasion. This may help guide future neck dissection, patient surveillance and radioiodine therapy doses.
Resumo:
Several medical and dental schools have described their experience in the transition from conventional to digital microscopy in the teaching of general pathology and histology disciplines; however, this transitional process has scarcely been reported in the teaching of oral pathology. Therefore, the objective of the current study is to report the transition from conventional glass slide to virtual microscopy in oral pathology teaching, a unique experience in Latin America. An Aperio ScanScope® scanner was used to digitalize histological slides used in practical lectures of oral pathology. The challenges and benefits observed by the group of Professors from the Piracicaba Dental School (Brazil) are described and a questionnaire to evaluate the students' compliance to this new methodology was applied. An improvement in the classes was described by the Professors who mainly dealt with questions related to pathological changes instead of technical problems; also, a higher interaction with the students was described. The simplicity of the software used and the high quality of the virtual slides, requiring a smaller time to identify microscopic structures, were considered important for a better teaching process. Virtual microscopy used to teach oral pathology represents a useful educational methodology, with an excellent compliance of the dental students.
Resumo:
The purpose of this study was to correlate the pre-operative imaging, vascularity of the proximal pole, and histology of the proximal pole bone of established scaphoid fracture non-union. This was a prospective non-controlled experimental study. Patients were evaluated pre-operatively for necrosis of the proximal scaphoid fragment by radiography, computed tomography (CT) and magnetic resonance imaging (MRI). Vascular status of the proximal scaphoid was determined intra-operatively, demonstrating the presence or absence of puncate bone bleeding. Samples were harvested from the proximal scaphoid fragment and sent for pathological examination. We determined the association between the imaging and intra-operative examination and histological findings. We evaluated 19 male patients diagnosed with scaphoid nonunion. CT evaluation showed no correlation to scaphoid proximal fragment necrosis. MRI showed marked low signal intensity on T1-weighted images that confirmed the histological diagnosis of necrosis in the proximal scaphoid fragment in all patients. Intra-operative assessment showed that 90% of bones had absence of intra-operative puncate bone bleeding, which was confirmed necrosis by microscopic examination. In scaphoid nonunion MRI images with marked low signal intensity on T1-weighted images and the absence of intra-operative puncate bone bleeding are strong indicatives of osteonecrosis of the proximal fragment.
Resumo:
Dahlstedtia Malme (Leguminosae) is a neotropical genus, native to the Brazilian Atlantic Forest, and comprises two species, D. pinnata (Benth.) Malme and D. pentaphylla (Taub.) Burk., although it has been considered a monotypic genus by some authors. Leaf anatomy was compared to verify the presence of anatomical characters to help delimit species. Foliar primordium, leaflet, petiolule, petiole and pulvinus were collected from cultivated plants (Campinas, SP, Brazil) and from natural populations (Picinguaba, Ubatuba and Caraguatatuba, SP, Brazil - D. pinnata; Antonina, PR, Brazil - D. pentaphylla). Studies on leaflet surface assessment (Scanning Electron Microscopy), as well as histology and venation analyses were carried out of dehydrated, fresh and fixed material from two species. Leaflet material was macerated for stomatal counts. Histological sections, obtained by free-hand cut or microtome, were stained with Toluidine Blue, Safranin/Alcian Blue, Ferric Chloride, Acid Phloroglucin. Secretory cavities are present in the lamina, petiolule, petiole, pulvinus and leaf primordium in D. pentaphylla, but not in D. pinnata, and can be considered an important character for species diagnosis. Other leaf characters were uninformative in delimiting Dahlstedtia species. There is cambial activity in the petiolule, petiole and pulvinus. This study, associated with other available data, supports the recognition of two species in Dahlstedtia.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.