The Real-life Experience With Cardiovascular Complications In The First Dose Of Fingolimod For Multiple Sclerosis.

Fingolimod is a new and efficient treatment for multiple sclerosis (MS). The drug administration requires special attention to the first dose, since cardiovascular adverse events can be observed during the initial six hours of fingolimod ingestion. The present study consisted of a review of cardiovascular data on 180 patients with MS receiving the first dose of fingolimod. The rate of bradycardia in these patients was higher than that observed in clinical trials with very strict inclusion criteria for patients. There were less than 10% of cases requiring special attention, but no fatal cases. All but one patient continued the treatment after this initial dose. This is the first report on real-life administration of fingolimod to Brazilian patients with MS, and one of the few studies with these characteristics in the world.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Long-term follow-up of an 8-year-old boy with insulinoma as the first manifestation of a familial form of multiple endocrine neoplasia type 1

Multiple endocrine neoplasia type 1 (MEN1) is an autosomal dominant hereditary cancer syndrome characterized mostly by parathyroid, enteropancreatic, and anterior pituitary tumors. We present a case of an 8-year-old boy referred because of hypoglycemic attacks. His diagnosis was pancreatic insulinoma. Paternal grandmother died due to repeated gastroduodenal ulcerations and a paternal aunt presented similar manifestations. At a first evaluation, the father presented only gastric ulceration but subsequently developed hyperparathyroidism and lung carcinoid tumor. During almost 15 years of follow-up, three brothers and the index case presented hyperparathyroidism and hyperprolactinemia. Molecular study showed a G to A substitution in intron 4, at nine nucleotides upstream of the splicing acceptor site, causing a splicing mutation. All affected members of the family have the same mutation. Paternal grandmother and aunt were not studied and the mother does not carry any mutation. MEN1 is a rare condition that requires permanent medical assistance. Early clinical and genetic identification of affected individuals is essential for their own surveillance and also for genetic counseling.

Success attitudes of young ophthalmologists in the first decade of their career

PURPOSE: To describe the main success attitudes of young ophthalmologists in the first decade of their career. METHODS: This descriptive study comprised subjects selected from a sample of ophthalmologists who were participating in a congress, using a semi-structured questionnaire. The inclusion criteria were as follows: ophthalmologists under the age of 40 years, within 5-10 years from ophthalmology residency conclusion. The subjects were asked about the three main success attitudes in their personal experience during the first years of ophthalmology practice. After the initial results, the 10 most frequently mentioned attitudes were listed and volunteers were again interviewed to choose, within the latter list, the three main attitudes. RESULTS: Forty-eight ophthalmologists were interviewed, 24 (50%) were male; the mean age was 37 years (SD: 2 years, range: 33-40 years) and the mean time from ophthalmology residency conclusion was 8 years (SD: 1 year, range: 5-10 years). The frequency of such mentioned success attitudes were as follows: to invest in professional updating (22.9%), to have a good relationship with patients and professional partners (18.8%), to prioritize individual and family happiness (12.5%), initially to work in an established group (11.1%), to work in public service (9.7%), to have their own business with a homogeneous group (7.6%), to save money (7.6%), to be ready to resume work (4.2%), to get business administration skills (4.2%), and to have professional insurance (0.7%). CONCLUSIONS: The three main success attitudes consisted in investing in professional updating (22.9%), maintaining a good relationship with patients and professional partners (18.8%), and prioritizing individual and family happiness (12.5%). Although these results should not be generalized, they are helpful not only for those ophthalmologists at the beginning of a career but also those who want to reflect on what to prioritize in their professional practice.