10 resultados para Field-scale
em Repositório da Produção Científica e Intelectual da Unicamp
Resumo:
Very high field (29)Si-NMR measurements using a fully (29)Si-enriched URu(2)Si(2) single crystal were carried out in order to microscopically investigate the hidden order (HO) state and adjacent magnetic phases in the high field limit. At the lowest measured temperature of 0.4 K, a clear anomaly reflecting a Fermi surface instability near 22 T inside the HO state is detected by the (29)Si shift, (29)K(c). Moreover, a strong enhancement of (29)K(c) develops near a critical field H(c) ≃ 35.6 T, and the ^{29}Si-NMR signal disappears suddenly at H(c), indicating the total suppression of the HO state. Nevertheless, a weak and shifted (29)Si-NMR signal reappears for fields higher than H(c) at 4.2 K, providing evidence for a magnetic structure within the magnetic phase caused by the Ising-type anisotropy of the uranium ordered moments.
Resumo:
Local parity-odd domains are theorized to form inside a quark-gluon plasma which has been produced in high-energy heavy-ion collisions. The local parity-odd domains manifest themselves as charge separation along the magnetic field axis via the chiral magnetic effect. The experimental observation of charge separation has previously been reported for heavy-ion collisions at the top RHIC energies. In this Letter, we present the results of the beam-energy dependence of the charge correlations in Au+Au collisions at midrapidity for center-of-mass energies of 7.7, 11.5, 19.6, 27, 39, and 62.4 GeV from the STAR experiment. After background subtraction, the signal gradually reduces with decreased beam energy and tends to vanish by 7.7 GeV. This implies the dominance of hadronic interactions over partonic ones at lower collision energies.
Resumo:
The layer-by-layer technique has been used as a powerful method to produce multilayer thin films with tunable properties. When natural polymers are employed, complicated phenomena such as self-aggregation and fibrilogenesis can occur, making it more difficult to obtain and characterize high-quality films. The weak acid and base character of such materials provides multilayer systems that may differ from those found with synthetic polymers due to strong self-organization effects. Specifically, LbL films prepared with chitosan and silk fibroin (SF) often involve the deposition of fibroin fibrils, which can influence the assembly process, surface properties, and overall film functionality. In this case, one has the intriguing possibility of realizing multilayer thin films with aligned nanofibers. In this article, we propose a strategy to control fibroin fibril formation by adjusting the assembly partner. Aligned fibroin fibrils were formed when chitosan was used as the counterpart, whereas no fibrils were observed when poly(allylamine hydrochloride) (PAH) was used. Charge density, which is higher in PAH, apparently stabilizes SF aggregates on the nanometer scale, thereby preventing their organization into fibrils. The drying step between the deposition of each layer was also crucial for film formation, as it stabilizes the SF molecules. Preliminary cell studies with optimized multilayers indicated that cell viability of NIH-3T3 fibroblasts remained between 90 and 100% after surface seeding, showing the potential application of the films in the biomedical field, as coatings and functional surfaces.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física