8 resultados para Field position (specific post)

em Repositório da Produção Científica e Intelectual da Unicamp


Relevância:

100.00% 100.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The efficacy of the human papillomavirus type 16 (HPV-16)/HPV-18 AS04-adjuvanted vaccine against cervical infections with HPV in the Papilloma Trial against Cancer in Young Adults (PATRICIA) was evaluated using a combination of the broad-spectrum L1-based SPF10 PCR-DNA enzyme immunoassay (DEIA)/line probe assay (LiPA25) system with type-specific PCRs for HPV-16 and -18. Broad-spectrum PCR assays may underestimate the presence of HPV genotypes present at relatively low concentrations in multiple infections, due to competition between genotypes. Therefore, samples were retrospectively reanalyzed using a testing algorithm incorporating the SPF10 PCR-DEIA/LiPA25 plus a novel E6-based multiplex type-specific PCR and reverse hybridization assay (MPTS12 RHA), which permits detection of a panel of nine oncogenic HPV genotypes (types 16, 18, 31, 33, 35, 45, 52, 58, and 59). For the vaccine against HPV types 16 and 18, there was no major impact on estimates of vaccine efficacy (VE) for incident or 6-month or 12-month persistent infections when the MPTS12 RHA was included in the testing algorithm versus estimates with the protocol-specified algorithm. However, the alternative testing algorithm showed greater sensitivity than the protocol-specified algorithm for detection of some nonvaccine oncogenic HPV types. More cases were gained in the control group than in the vaccine group, leading to higher point estimates of VE for 6-month and 12-month persistent infections for the nonvaccine oncogenic types included in the MPTS12 RHA assay (types 31, 33, 35, 45, 52, 58, and 59). This post hoc analysis indicates that the per-protocol testing algorithm used in PATRICIA underestimated the VE against some nonvaccine oncogenic HPV types and that the choice of the HPV DNA testing methodology is important for the evaluation of VE in clinical trials. (This study has been registered at ClinicalTrials.gov under registration no. NCT00122681.).

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Fisica