15 resultados para FUNGAL PATHOGEN

em Repositório da Produção Científica e Intelectual da Unicamp


Relevância:

100.00% 100.00%

Publicador:

Resumo:

Witches' broom disease (WBD), caused by the hemibiotrophic fungus Moniliophthora perniciosa, is one of the most devastating diseases of Theobroma cacao, the chocolate tree. In contrast to other hemibiotrophic interactions, the WBD biotrophic stage lasts for months and is responsible for the most distinctive symptoms of the disease, which comprise drastic morphological changes in the infected shoots. Here, we used the dual RNA-seq approach to simultaneously assess the transcriptomes of cacao and M. perniciosa during their peculiar biotrophic interaction. Infection with M. perniciosa triggers massive metabolic reprogramming in the diseased tissues. Although apparently vigorous, the infected shoots are energetically expensive structures characterized by the induction of ineffective defense responses and by a clear carbon deprivation signature. Remarkably, the infection culminates in the establishment of a senescence process in the host, which signals the end of the WBD biotrophic stage. We analyzed the pathogen's transcriptome in unprecedented detail and thereby characterized the fungal nutritional and infection strategies during WBD and identified putative virulence effectors. Interestingly, M. perniciosa biotrophic mycelia develop as long-term parasites that orchestrate changes in plant metabolism to increase the availability of soluble nutrients before plant death. Collectively, our results provide unique insight into an intriguing tropical disease and advance our understanding of the development of (hemi)biotrophic plant-pathogen interactions.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The 'dilution effect' (DE) hypothesis predicts that diverse host communities will show reduced disease. The underlying causes of pathogen dilution are complex, because they involve non-additive (driven by host interactions and differential habitat use) and additive (controlled by host species composition) mechanisms. Here, we used measures of complementarity and selection traditionally employed in the field of biodiversity-ecosystem function (BEF) to quantify the net effect of host diversity on disease dynamics of the amphibian-killing fungus Batrachochytrium dendrobatidis (Bd). Complementarity occurs when average infection load in diverse host assemblages departs from that of each component species in uniform populations. Selection measures the disproportionate impact of a particular species in diverse assemblages compared with its performance in uniform populations, and therefore has strong additive and non-additive properties. We experimentally infected tropical amphibian species of varying life histories, in single- and multi-host treatments, and measured individual Bd infection loads. Host diversity reduced Bd infection in amphibians through a mechanism analogous to complementarity (sensu BEF), potentially by reducing shared habitat use and transmission among hosts. Additionally, the selection component indicated that one particular terrestrial species showed reduced infection loads in diverse assemblages at the expense of neighbouring aquatic hosts becoming heavily infected. By partitioning components of diversity, our findings underscore the importance of additive and non-additive mechanisms underlying the DE.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Silver nanoparticles have attracted considerable attention due to their beneficial properties. But toxicity issues associated with them are also rising. The reports in the past suggested health hazards of silver nanoparticles at the cellular, molecular, or whole organismal level in eukaryotes. Whereas, there is also need to examine the exposure effects of silver nanoparticle to the microbes, which are beneficial to humans as well as environment. The available literature suggests the harmful effects of physically and chemically synthesised silver nanoparticles. The toxicity of biogenically synthesized nanoparticles has been less studied than physically and chemically synthesised nanoparticles. Hence, there is a greater need to study the toxic effects of biologically synthesised silver nanoparticles in general and mycosynthesized nanoparticles in particular. In the present study, attempts have been made to assess the risk associated with the exposure of mycosynthesized silver nanoparticles on a beneficial soil microbe Pseudomonas putida. KT2440. The study demonstrates mycosynthesis of silver nanoparticles and their characterisation by UV-vis spectrophotometry, FTIR, X-ray diffraction, nanosight LM20 - a particle size distribution analyzer and TEM. Silver nanoparticles obtained herein were found to exert the hazardous effect at the concentration of 0.4μg/ml, which warrants further detailed investigations concerning toxicity.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The present work aimed to investigate the diversity of bacteria and filamentous fungi of southern Atlantic Ocean marine sponge Dragmacidon reticulatum using cultivation-independent approaches. Fungal ITS rDNA and 18S gene analyses (DGGE and direct sequencing approaches) showed the presence of representatives of three order (Polyporales, Malasseziales, and Agaricales) from the phylum Basidiomycota and seven orders belonging to the phylum Ascomycota (Arthoniales, Capnodiales, Dothideales, Eurotiales, Hypocreales, Pleosporales, and Saccharomycetales). On the other hand, bacterial 16S rDNA gene analyses by direct sequencing approach revealed the presence of representatives of seven bacterial phyla (Cyanobacteria, Proteobacteria, Actinobacteria, Bacteroidetes, Lentisphaerae, Chloroflexi, and Planctomycetes). Results from statistical analyses (rarefaction curves) suggested that the sampled clones covered the fungal diversity in the sponge samples studied, while for the bacterial community additional sampling would be necessary for saturation. This is the first report related to the molecular analyses of fungal and bacterial communities by cultivation-independent approaches in the marine sponges D. reticulatum. Additionally, the present work broadening the knowledge of microbial diversity associated to marine sponges and reports innovative data on the presence of some fungal genera in marine samples.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The aim of this clinical study was to determine the efficacy of Uncaria tomentosa (cat's claw) against denture stomatitis (DS). Fifty patients with DS were randomly assigned into 3 groups to receive 2% miconazole, placebo, or 2% U tomentosa gel. DS level was recorded immediately, after 1 week of treatment, and 1 week after treatment. The clinical effectiveness of each treatment was measured using Newton's criteria. Mycologic samples from palatal mucosa and prosthesis were obtained to determinate colony forming units per milliliter (CFU/mL) and fungal identification at each evaluation period. Candida species were identified with HiCrome Candida and API 20C AUX biochemical test. DS severity decreased in all groups (P < .05). A significant reduction in number of CFU/mL after 1 week (P < .05) was observed for all groups and remained after 14 days (P > .05). C albicans was the most prevalent microorganism before treatment, followed by C tropicalis, C glabrata, and C krusei, regardless of the group and time evaluated. U tomentosa gel had the same effect as 2% miconazole gel. U tomentosa gel is an effective topical adjuvant treatment for denture stomatitis.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Streptococcus sanguinis is a commensal pioneer colonizer of teeth and an opportunistic pathogen of infectious endocarditis. The establishment of S. sanguinis in host sites likely requires dynamic fitting of the cell wall in response to local stimuli. In this study, we investigated the two-component system (TCS) VicRK in S. sanguinis (VicRKSs), which regulates genes of cell wall biogenesis, biofilm formation, and virulence in opportunistic pathogens. A vicK knockout mutant obtained from strain SK36 (SKvic) showed slight reductions in aerobic growth and resistance to oxidative stress but an impaired ability to form biofilms, a phenotype restored in the complemented mutant. The biofilm-defective phenotype was associated with reduced amounts of extracellular DNA during aerobic growth, with reduced production of H2O2, a metabolic product associated with DNA release, and with inhibitory capacity of S. sanguinis competitor species. No changes in autolysis or cell surface hydrophobicity were detected in SKvic. Reverse transcription-quantitative PCR (RT-qPCR), electrophoretic mobility shift assays (EMSA), and promoter sequence analyses revealed that VicR directly regulates genes encoding murein hydrolases (SSA_0094, cwdP, and gbpB) and spxB, which encodes pyruvate oxidase for H2O2 production. Genes previously associated with spxB expression (spxR, ccpA, ackA, and tpK) were not transcriptionally affected in SKvic. RT-qPCR analyses of S. sanguinis biofilm cells further showed upregulation of VicRK targets (spxB, gbpB, and SSA_0094) and other genes for biofilm formation (gtfP and comE) compared to expression in planktonic cells. This study provides evidence that VicRKSs regulates functions crucial for S. sanguinis establishment in biofilms and identifies novel VicRK targets potentially involved in hydrolytic activities of the cell wall required for these functions.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The phytopathogenic fungus Moniliophthora perniciosa (Stahel) Aime & Philips-Mora, causal agent of witches' broom disease of cocoa, causes countless damage to cocoa production in Brazil. Molecular studies have attempted to identify genes that play important roles in fungal survival and virulence. In this study, sequences deposited in the M. perniciosa Genome Sequencing Project database were analyzed to identify potential biological targets. For the first time, the ergosterol biosynthetic pathway in M. perniciosa was studied and the lanosterol 14α-demethylase gene (ERG11) that encodes the main enzyme of this pathway and is a target for fungicides was cloned, characterized molecularly and its phylogeny analyzed. ERG11 genomic DNA and cDNA were characterized and sequence analysis of the ERG11 protein identified highly conserved domains typical of this enzyme, such as SRS1, SRS4, EXXR and the heme-binding region (HBR). Comparison of the protein sequences and phylogenetic analysis revealed that the M. perniciosa enzyme was most closely related to that of Coprinopsis cinerea.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

It is well known that trichomes protect plant organs, and several studies have investigated their role in the adaptation of plants to harsh environments. Recent studies have shown that the production of hydrophilic substances by glandular trichomes and the deposition of this secretion on young organs may facilitate water retention, thus preventing desiccation and favouring organ growth until the plant develops other protective mechanisms. Lychnophora diamantinana is a species endemic to the Brazilian 'campos rupestres' (rocky fields), a region characterized by intense solar radiation and water deficits. This study sought to investigate trichomes and the origin of the substances observed on the stem apices of L. diamantinana. Samples of stem apices, young and expanded leaves were studied using standard techniques, including light microscopy and scanning and transmission electron microscopy. Histochemical tests were used to identify the major groups of metabolites present in the trichomes and the hyaline material deposited on the apices. Non-glandular trichomes and glandular trichomes were observed. The material deposited on the stem apices was hyaline, highly hydrophilic and viscous. This hyaline material primarily consists of carbohydrates that result from the partial degradation of the cell wall of uniseriate trichomes. This degradation occurs at the same time that glandular trichomes secrete terpenoids, phenolic compounds and proteins. These results suggest that the non-glandular trichomes on the leaves of L. diamantinana help protect the young organ, particularly against desiccation, by deposition of highly hydrated substances on the apices. Furthermore, the secretion of glandular trichomes probably repels herbivore and pathogen attacks.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Witches' broom disease (WBD) of cacao differs from other typical hemibiotrophic plant diseases by its unusually long biotrophic phase. Plant carbon sources have been proposed to regulate WBD developmental transitions; however, nothing is known about their availability at the plant-fungus interface, the apoplastic fluid of cacao. Data are provided supporting a role for the dynamics of soluble carbon in the apoplastic fluid in prompting the end of the biotrophic phase of infection. Carbon depletion and the consequent fungal sensing of starvation were identified as key signalling factors at the apoplast. MpNEP2, a fungal effector of host necrosis, was found to be up-regulated in an autophagic-like response to carbon starvation in vitro. In addition, the in vivo artificial manipulation of carbon availability in the apoplastic fluid considerably modulated both its expression and plant necrosis rate. Strikingly, infected cacao tissues accumulated intracellular hexoses, and showed stunted photosynthesis and the up-regulation of senescence markers immediately prior to the transition to the necrotrophic phase. These opposite findings of carbon depletion and accumulation in different host cell compartments are discussed within the frame of WBD development. A model is suggested to explain phase transition as a synergic outcome of fungal-related factors released upon sensing of extracellular carbon starvation, and an early senescence of infected tissues probably triggered by intracellular sugar accumulation.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Bartonella species are blood-borne, re-emerging organisms, capable of causing prolonged infection with diverse disease manifestations, from asymptomatic bacteremia to chronic debilitating disease and death. This pathogen can survive for over a month in stored blood. However, its prevalence among blood donors is unknown, and screening of blood supplies for this pathogen is not routinely performed. We investigated Bartonella spp. prevalence in 500 blood donors from Campinas, Brazil, based on a cross-sectional design. Blood samples were inoculated into an enrichment liquid growth medium and sub-inoculated onto blood agar. Liquid culture samples and Gram-negative isolates were tested using a genus specific ITS PCR with amplicons sequenced for species identification. Bartonella henselae and Bartonella quintana antibodies were assayed by indirect immunofluorescence. B. henselae was isolated from six donors (1.2%). Sixteen donors (3.2%) were Bartonella-PCR positive after culture in liquid or on solid media, with 15 donors infected with B. henselae and one donor infected with Bartonella clarridgeiae. Antibodies against B. henselae or B. quintana were found in 16% and 32% of 500 blood donors, respectively. Serology was not associated with infection, with only three of 16 Bartonella-infected subjects seropositive for B. henselae or B. quintana. Bartonella DNA was present in the bloodstream of approximately one out of 30 donors from a major blood bank in South America. Negative serology does not rule out Bartonella spp. infection in healthy subjects. Using a combination of liquid and solid cultures, PCR, and DNA sequencing, this study documents for the first time that Bartonella spp. bacteremia occurs in asymptomatic blood donors. Our findings support further evaluation of Bartonella spp. transmission which can occur through blood transfusions.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Neutrophils (PMN) play a central role in host defense against the neglected fungal infection paracoccidioidomycosis (PCM), which is caused by the dimorphic fungus Paracoccidioides brasiliensis (Pb). PCM is of major importance, especially in Latin America, and its treatment relies on the use of antifungal drugs. However, the course of treatment is lengthy, leading to side effects and even development of fungal resistance. The goal of the study was to use low-level laser therapy (LLLT) to stimulate PMN to fight Pb in vivo. Swiss mice with subcutaneous air pouches were inoculated with a virulent strain of Pb or fungal cell wall components (Zymosan), and then received LLLT (780 nm; 50 mW; 12.5 J/cm2; 30 seconds per point, giving a total energy of 0.5 J per point) on alternate days at two points on each hind leg. The aim was to reach the bone marrow in the femur with light. Non-irradiated animals were used as controls. The number and viability of the PMN that migrated to the inoculation site was assessed, as well as their ability to synthesize proteins, produce reactive oxygen species (ROS) and their fungicidal activity. The highly pure PMN populations obtained after 10 days of infection were also subsequently cultured in the presence of Pb for trials of protein production, evaluation of mitochondrial activity, ROS production and quantification of viable fungi growth. PMN from mice that received LLLT were more active metabolically, had higher fungicidal activity against Pb in vivo and also in vitro. The kinetics of neutrophil protein production also correlated with a more activated state. LLLT may be a safe and non-invasive approach to deal with PCM infection.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Oropouche virus (OROV) is a member of the Orthobunyavirus genus in the Bunyaviridae family and a prominent cause of insect-transmitted viral disease in Central and South America. Despite its clinical relevance, little is known about OROV pathogenesis. To define the host defense pathways that control OROV infection and disease, we evaluated OROV pathogenesis and immune responses in primary cells and mice that were deficient in the RIG-I-like receptor signaling pathway (MDA5, RIG-I, or MAVS), downstream regulatory transcription factors (IRF-3 or IRF-7), IFN-β, or the receptor for type I IFN signaling (IFNAR). OROV replicated to higher levels in primary fibroblasts and dendritic cells lacking MAVS signaling, the transcription factors IRF-3 and IRF-7, or IFNAR. In mice, deletion of IFNAR, MAVS, or IRF-3 and IRF-7 resulted in uncontrolled OROV replication, hypercytokinemia, extensive liver damage, and death whereas wild-type (WT) congenic animals failed to develop disease. Unexpectedly, mice with a selective deletion of IFNAR on myeloid cells (CD11c Cre(+) Ifnar(f/f) or LysM Cre(+) Ifnar(f/f)) did not sustain enhanced disease with OROV or La Crosse virus, a closely related encephalitic orthobunyavirus. In bone marrow chimera studies, recipient irradiated Ifnar(-/-) mice reconstituted with WT hematopoietic cells sustained high levels of OROV replication and liver damage, whereas WT mice reconstituted with Ifnar(-/-) bone marrow were resistant to disease. Collectively, these results establish a dominant protective role for MAVS, IRF-3 and IRF-7, and IFNAR in restricting OROV virus infection and tissue injury, and suggest that IFN signaling in non-myeloid cells contributes to the host defense against orthobunyaviruses. Oropouche virus (OROV) is an emerging arthropod-transmitted orthobunyavirus that causes episodic outbreaks of a debilitating febrile illness in humans in countries of South and Central America. The continued expansion of the range and number of its arthropod vectors increases the likelihood that OROV will spread into new regions. At present, the pathogenesis of OROV in humans or other vertebrate animals remains poorly understood. To define cellular mechanisms of control of OROV infection, we performed infection studies in a series of primary cells and mice that were deficient in key innate immune genes involved in pathogen recognition and control. Our results establish that a MAVS-dependent type I IFN signaling pathway has a dominant role in restricting OROV infection and pathogenesis in vivo.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

We report the case of a 73-year-old female who presented facial numbness and pain in the first division of the trigeminal nerve, ptosis, diplopia and visual loss on the right side for the previous four months. The neurological, radiological and histological examination demonstrated a rare case of invasive fungal aspergillosis of the central nervous system, causing orbital apex syndrome, later transformed in temporal brain abscess. She died ten months later due to respiratory and renal failure in spite of specific antimycotic therapy.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Cutinases (EC 3.1.1.74) are also known as cutin hidrolases. These enzymes share catalytic properties of lipases and esterases, presenting a unique feature of being active regardless the presence of an oil-water interface, making them interesting as biocatalysts in several industrial processes involving hydrolysis, esterification and trans-esterification reactions. They are also active in different reaction media, allowing their applications in different areas such as food industry, cosmetics, fine chemicals, pesticide and insecticide degradation, treatment and laundry of fiber textiles and polymer chemistry. The present review describes the characteristics, potential applications and new perspectives for these enzymes.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.