The use of fluorescence in situ hybridization in the diagnosis of hidden mosaicism: apropos of three cases of sex chromosome anomalies

FISH has been used as a complement to classical cytogenetics in the detection of mosaicism in sex chromosome anomalies. The aim of this study is to describe three cases in which the final diagnosis could only be achieved by FISH. Case 1 was an 8-year-old 46,XY girl with normal female genitalia referred to our service because of short stature. FISH analysis of lymphocytes with probes for the X and Y centromeres identified a 45,X/46,X,idic(Y) constitution, and established the diagnosis of Turner syndrome. Case 2 was a 21-month-old 46,XY boy with genital ambiguity (penile hypospadias, right testis, and left streak gonad). FISH analysis of lymphocytes and buccal smear identified a 45,X/46,XY karyotype, leading to diagnosis of mixed gonadal dysgenesis. Case 3 was a 47,XYY 19-year-old boy with delayed neuromotor development, learning disabilities, psychological problems, tall stature, small testes, elevated gonadotropins, and azoospermia. FISH analysis of lymphocytes and buccal smear identified a 47,XYY/48,XXYY constitution. Cases 1 and 2 illustrate the phenotypic variability of the 45,X/46,XY mosaicism, and the importance of detection of the 45,X cell line for proper management and follow-up. In case 3, abnormal gonadal function could be explained by the 48,XXYY cell line. The use of FISH in clinical practice is particularly relevant when classical cytogenetic analysis yields normal or uncertain results in patients with features of sex chromosome aneuploidy. Arq Bras Endocrinol Metab. 2012;56(8):545-51

Measuring The Hydrodynamic Radius Of Quantum Dots By Fluorescence Correlation Spectroscopy.

Fluorescence Correlation Spectroscopy (FCS) is an optical technique that allows the measurement of the diffusion coefficient of molecules in a diluted sample. From the diffusion coefficient it is possible to calculate the hydrodynamic radius of the molecules. For colloidal quantum dots (QDs) the hydrodynamic radius is valuable information to study interactions with other molecules or other QDs. In this chapter we describe the main aspects of the technique and how to use it to calculate the hydrodynamic radius of quantum dots (QDs).

Fluorescence, Aggregation Properties And Ft-ir Microspectroscopy Of Elastin And Collagen Fibers.

Histological and histochemical observations support the hypothesis that collagen fibers can link to elastic fibers. However, the resulting organization of elastin and collagen type complexes and differences between these materials in terms of macromolecular orientation and frequencies of their chemical vibrational groups have not yet been solved. This study aimed to investigate the macromolecular organization of pure elastin, collagen type I and elastin-collagen complexes using polarized light DIC-microscopy. Additionally, differences and similarities between pure elastin and collagen bundles (CB) were investigated by Fourier transform-infrared (FT-IR) microspectroscopy. Although elastin exhibited a faint birefringence, the elastin-collagen complex aggregates formed in solution exhibited a deep birefringence and formation of an ordered-supramolecular complex typical of collagen chiral structure. The FT-IR study revealed elastin and CB peptide NH groups involved in different types of H-bonding. More energy is absorbed in the vibrational transitions corresponding to CH, CH2 and CH3 groups (probably associated with the hydrophobicity demonstrated by 8-anilino-1-naphtalene sulfonic acid sodium salt [ANS] fluorescence), and to νCN, δNH and ωCH2 groups of elastin compared to CB. It is assumed that the α-helix contribution to the pure elastin amide I profile is 46.8%, whereas that of the B-sheet is 20% and that unordered structures contribute to the remaining percentage. An FT-IR profile library reveals that the elastin signature within the 1360-1189cm(-1) spectral range resembles that of Conex-Toray aramid fibers.

The Lea Grating Test In Assessing Detection Grating Acuity In Normal Infants Less Than 4 Months Of Age.

To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.

Analysis Of The Fluorescence Of Body Fluids On Different Surfaces And Times.

The use of screening techniques, such as an alternative light source (ALS), is important for finding biological evidence at a crime scene. The objective of this study was to evaluate whether biological fluid (blood, semen, saliva, and urine) deposited on different surfaces changes as a function of the age of the sample. Stains were illuminated with a Megamaxx™ ALS System and photographed with a Canon EOS Utility™ camera. Adobe Photoshop™ was utilized to prepare photographs for analysis, and then ImageJ™ was used to record the brightness values of pixels in the images. Data were submitted to analysis of variance using a generalized linear mixed model with two fixed effects (surface and fluid). Time was treated as a random effect (through repeated measures) with a first-order autoregressive covariance structure. Means of significant effects were compared by the Tukey test. The fluorescence of the analyzed biological material varied depending on the age of the sample. Fluorescence was lower when the samples were moist. Fluorescence remained constant when the sample was dry, up to the maximum period analyzed (60 days), independent of the substrate on which the fluid was deposited, showing the novelty of this study. Therefore, the forensic expert can detect biological fluids at the crime scene using an ALS even several days after a crime has occurred.

Determination Of Tetrakis(hydroxymethyl)phosphonium Sulfate In Commercial Formulations And Cooling Water By Capillary Electrophoresis With Contactless Conductivity Detection.

A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.

Human Herpesvirus Infections Of The Central Nervous System: Laboratory Diagnosis Based On Dna Detection By Nested Pcr In Plasma And Cerebrospinal Fluid Samples.

Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.

Detection Of Explosives On The Surface Of Banknotes By Raman Hyperspectral Imaging And Independent Component Analysis.

The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).

Measurement Of The Hydrodynamic Radius Of Quantum Dots By Fluorescence Correlation Spectroscopy Excluding Blinking.

One of the most important properties of quantum dots (QDs) is their size. Their size will determine optical properties and in a colloidal medium their range of interaction. The most common techniques used to measure QD size are transmission electron microscopy (TEM) and X-ray diffraction. However, these techniques demand the sample to be dried and under a vacuum. This way any hydrodynamic information is excluded and the preparation process may alter even the size of the QDs. Fluorescence correlation spectroscopy (FCS) is an optical technique with single molecule sensitivity capable of extracting the hydrodynamic radius (HR) of the QDs. The main drawback of FCS is the blinking phenomenon that alters the correlation function implicating in a QD apparent size smaller than it really is. In this work, we developed a method to exclude blinking of the FCS and measured the HR of colloidal QDs. We compared our results with TEM images, and the HR obtained by FCS is higher than the radius measured by TEM. We attribute this difference to the cap layer of the QD that cannot be seen in the TEM images.

Fast And Direct Na And K Determination In Table, Marine, And Low-sodium Salts By X-ray Fluorescence And Chemometrics.

X-ray fluorescence (XRF) is a fast, low-cost, nondestructive, and truly multielement analytical technique. The objectives of this study are to quantify the amount of Na(+) and K(+) in samples of table salt (refined, marine, and light) and to compare three different methodologies of quantification using XRF. A fundamental parameter method revealed difficulties in quantifying accurately lighter elements (Z < 22). A univariate methodology based on peak area calibration is an attractive alternative, even though additional steps of data manipulation might consume some time. Quantifications were performed with good correlations for both Na (r = 0.974) and K (r = 0.992). A partial least-squares (PLS) regression method with five latent variables was very fast. Na(+) quantifications provided calibration errors lower than 16% and a correlation of 0.995. Of great concern was the observation of high Na(+) levels in low-sodium salts. The presented application may be performed in a fast and multielement fashion, in accordance with Green Chemistry specifications.

Um novo método para quantificar mercúrio orgânico (Hg orgânico) empregando a espectrometria de fluorescência atômica do vapor frio

In this work a simple and sensitive procedure to extract organic mercury from water and sediment samples, using methylene chloride in acidic media followed by CVAFS quantification has been developed. The method was evaluated for possible interferents, using different inorganic mercury species and humic acid, no effects being observed. The detection limit for organic mercury was 160 pg and 396 pg for water and sediment samples respectively. The accuracy of the method was evaluated using a certified reference material of methylmercury (BCR-580, estuarine sediment). Recovery tests using methylmercury as surrogate spiked with 1.0 up to 30.0 ng L-1 ranged from 90 up to 109% for water samples, whereas for sediments, recoveries ranged from 57 up to 97%.

A screening method for detection of hexavalent chromium levels in soils

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.