4 resultados para FEC using Reed-Solomon-like codes

em Repositório da Produção Científica e Intelectual da Unicamp


Relevância:

100.00% 100.00%

Publicador:

Resumo:

Universidade Estadual de Campinas. Faculdade de Educação Física

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Chlorophenylpiperazines (CPP) are psychotropic drugs used in nightclub parties and are frequently used in a state of sleep deprivation, a condition which can potentiate the effects of psychoactive drugs. This study aimed to investigate the effects of sleep deprivation and sleep rebound (RB) on anxiety-like measures in mCPP-treated mice using the open field test. We first optimized our procedure by performing dose-effect curves and examining different pretreatment times in naïve male Swiss mice. Subsequently, a separate cohort of mice underwent paradoxical sleep deprivation (PSD) for 24 or 48h. In the last experiment, immediately after the 24h-PSD period, mice received an injection of saline or mCPP, but their general activity was quantified in the open field only after the RB period (24 or 48h). The dose of 5mgmL(-1) of mCPP was the most effective at decreasing rearing behavior, with peak effects 15min after injection. PSD decreased locomotion and rearing behaviors, thereby inhibiting a further impairment induced by mCPP. Plasma concentrations of mCPP were significantly higher in PSD 48h animals compared to the non-PSD control group. Twenty-four hours of RB combined with mCPP administration produced a slight reduction in locomotion. Our results show that mCPP was able to significantly change the behavior of naïve, PSD, and RB mice. When combined with sleep deprivation, there was a higher availability of drug in plasma levels. Taken together, our results suggest that sleep loss can enhance the behavioral effects of the potent psychoactive drug, mCPP, even after a period of rebound sleep.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

El Niño South Oscillation (ENSO) is one climatic phenomenon related to the inter-annual variability of global meteorological patterns influencing sea surface temperature and rainfall variability. It influences human health indirectly through extreme temperature and moisture conditions that may accelerate the spread of some vector-borne viral diseases, like dengue fever (DF). This work examines the spatial distribution of association between ENSO and DF in the countries of the Americas during 1995-2004, which includes the 1997-1998 El Niño, one of the most important climatic events of 20(th) century. Data regarding the South Oscillation index (SOI), indicating El Niño-La Niña activity, were obtained from Australian Bureau of Meteorology. The annual DF incidence (AIy) by country was computed using Pan-American Health Association data. SOI and AIy values were standardised as deviations from the mean and plotted in bars-line graphics. The regression coefficient values between SOI and AIy (rSOI,AI) were calculated and spatially interpolated by an inverse distance weighted algorithm. The results indicate that among the five years registering high number of cases (1998, 2002, 2001, 2003 and 1997), four had El Niño activity. In the southern hemisphere, the annual spatial weighted mean centre of epidemics moved southward, from 6° 31' S in 1995 to 21° 12' S in 1999 and the rSOI,AI values were negative in Cuba, Belize, Guyana and Costa Rica, indicating a synchrony between higher DF incidence rates and a higher El Niño activity. The rSOI,AI map allows visualisation of a graded surface with higher values of ENSO-DF associations for Mexico, Central America, northern Caribbean islands and the extreme north-northwest of South America.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.