Pedagogia do treinamento : metodo, procedimentos pedagogicos e as multiplas competencias do tecnico nos jogos desportivos coletivos

Universidade Estadual de Campinas. Faculdade de Educação Física

Da preparação preliminar ao nivel olimpico : um estudo de caso no remo brasileiro feminino

Universidade Estadual de Campinas . Faculdade de Educação Física

O processo de ensino dos jogos desportivos coletivos : um estudo acerca do basquetebol

Universidade Estadual de Campinas . Faculdade de Educação Física

Jogos desportivos coletivos e os estimulos das inteligencias multiplas : bases para uma proposta em pedagogia do esporte

Universidade Estadual de Campinas. Faculdade de Educação Física

Quality Of Life On Arterial Hypertension: Validity Of Known Groups Of Minichal.

Introductions: In the care of hypertension, it is important that health professionals possess available tools that allow evaluating the impairment of the health-related quality of life, according to the severity of hypertension and the risk for cardiovascular events. Among the instruments developed for the assessment of health-related quality of life, there is the Mini-Cuestionario of Calidad de Vida en la Hipertensión Arterial (MINICHAL) recently adapted to the Brazilian culture. Objective: To estimate the validity of known groups of the Brazilian version of the MINICHAL regarding the classification of risk for cardiovascular events, symptoms, severity of dyspnea and target-organ damage. Methods: Data of 200 hypertensive outpatients concerning sociodemographic and clinical information and health-related quality of life were gathered by consulting the medical charts and the application of the Brazilian version of MINICHAL. The Mann-Whitney test was used to compare health-related quality of life in relation to symptoms and target-organ damage. The Kruskal-Wallis test and ANOVA with ranks transformation were used to compare health-related quality of life in relation to the classification of risk for cardiovascular events and intensity of dyspnea, respectively. Results: The MINICHAL was able to discriminate health-related quality of life in relation to symptoms and kidney damage, but did not discriminate health-related quality of life in relation to the classification of risk for cardiovascular events. Conclusion: The Brazilian version of the MINICHAL is a questionnaire capable of discriminating differences on the health‑related quality of life regarding dyspnea, chest pain, palpitation, lipothymy, cephalea and renal damage.Fundamento: No cuidado ao hipertenso, é importante que o profissional de saúde disponha de ferramentas que possibilitem avaliar o comprometimento da qualidade de vida relacionada à saúde, de acordo com a gravidade da hipertensão e o risco para eventos cardiovasculares. Dentre os instrumentos criados para avaliação da qualidade de vida relacionada à saúde, destaca-se o Mini-Cuestionario de Calidad de Vida en la Hipertensión Arterial (MINICHAL), recentemente adaptado para a cultura brasileira. Objetivo: Estimar a validade de grupos conhecidos da versão brasileira do MINICHAL em relação à classificação de risco para eventos cardiovasculares, sintomas, intensidade da dispneia e lesões de órgãos-alvo. Métodos: Foram investigados 200 hipertensos em seguimento ambulatorial, cujos dados sociodemográficos, clínicos e de qualidade de vida relacionada à saúde foram obtidos por meio de consulta ao prontuário e da aplicação da versão brasileira do MINICHAL. O teste de Mann-Whitney foi utilizado para comparar qualidade de vida relacionada à saúde em relação aos sintomas e às lesões de órgãos-alvo. Teste de Kruskal-Wallis e ANOVA com transformação nos ranks foram empregados para comparar qualidade de vida relacionada à saúde em relação à classificação de risco para eventos cardiovasculares e intensidade da dispneia, respectivamente. Resultados: O MINICHAL discriminou qualidade de vida relacionada à saúde em relação aos sintomas e dano renal (lesões de órgãos-alvo), porém não discriminou qualidade de vida relacionada à saúde em relação à classificação de risco para eventos cardiovasculares. Conclusão: A versão brasileira do MINICHAL é um instrumento capaz de discriminar diferenças na qualidade de vida relacionada à saúde em relação aos sintomas de dispneia, precordialgia, palpitação, lipotímia, cefaleia e presença de dano renal.

Formação de conceitos em crianças cegas: questões teóricas e implicações educacionais

Concept formation depends on language and thought, that promote the integration of information coming from the senses. It is postulated that changes in the person, the objects and events to be known suggest flexible models of concept teaching. It is assumed that the same considerations apply to teaching concepts to blind pupils. Specificities of this process are discussed, including the role of touch as resource, although not as a direct substitute to vision, and the notion of representation as a basis for the elaboration of pedagogical resources for the blind student.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Comparative analysis of adverse events between infliximab and adalimumab in Crohn's disease management: a Brazilian single-centre experience

INTRODUCTION: Data is scarce regarding adverse events (AE) of biological therapy used in the management of Crohn's Disease (CD) among Brazilian patients. OBJECTIVES: To analyse AE prevalence and profile in patients with CD treated with Infliximab (IFX) or Adalimumab (ADA) and to verify whether there are differences between the two drugs. METHOD: Retrospective observational single-centre study of CD patients on biological therapy. Variables analysed: Demographic data, Montreal classification, biological agent administered, treatment duration, presence and type of AE and the need for treatment interruption. RESULTS: Forty-nine patients were analysed, 25 treated with ADA and 24 with IFX. The groups were homogeneous in relation to the variables studied. The average follow-up period for the group treated with ADA was 19.3 months and 21.8 months for the IFX group (p = 0.585). Overall, 40% (n = 10) of patients taking ADA had AE compared with 50% (n = 12) of IFX users (p = 0.571). There was a tendency towards higher incidence of cutaneous and infusion reactions in the IFX group and higher incidence of infections in the ADA treated group, although without significant difference. CONCLUSIONS: No difference was found in the AE prevalence and profile between ADA and IFX CD patients in the population studied.

Programação esportiva na TV Brasil : a influência da ideologia e indústria cultural

Universidade Estadual de Campinas . Faculdade de Educação Física

Realidade da olimpíada colegial do estado de São Paulo (OCESP) em relação ao discurso presente na educação física acerca da competição escolar : estudo da região leste de Campinas

Universidade Estadual de Campinas . Faculdade de Educação Física

Significados do taiko no Instituto Cultural Nipo Brasileiro de Campinas

Universidade Estadual de Campinas . Faculdade de Educação Física

O rugbi em cadeira de rodas : aspectos tecnicos e taticos e diretrizes para seu desenvolvimento

Universidade Estadual de Campinas . Faculdade de Educação Física

A Educação Fisica e o discurso midiatico : abordagem critico-emancipatoria em pesquisa-ação no ensino de graduação. Subsidios para a saude?

Universidade Estadual de Campinas . Faculdade de Educação Física

Auto-organização no comportamento de crianças no jogo

Universidade Estadual de Campinas . Faculdade de Educação Física

Barreiras socio-culturais e lazer das pessoas portadoras de deficiencia fisica : um estudo do grupo Fraternidade Cristã de Doença e Deficiencia de Campinas, SP

Universidade Estadual de Campinas. Faculdade de Educação Física