Trends and strategies of ozone application in environmental problems

Efforts presented by the scientific community in recent years towards the development of numerous green chemical processes and wastewater treatment technologies are presented and discussed. In the light of these approaches, environmentally friendly technologies, as well as the key role played by the well-known advanced oxidation processes, are discussed, giving special attention to the ones comprising ozone applications. Fundamentals and applied aspects dealing with ozone technology and its application are also presented.

Long-term Prospects For The Environmental Profile Of Advanced Sugar Cane Ethanol.

This work assessed the environmental impacts of the production and use of 1 MJ of hydrous ethanol (E100) in Brazil in prospective scenarios (2020-2030), considering the deployment of technologies currently under development and better agricultural practices. The life cycle assessment technique was employed using the CML method for the life cycle impact assessment and the Monte Carlo method for the uncertainty analysis. Abiotic depletion, global warming, human toxicity, ecotoxicity, photochemical oxidation, acidification, and eutrophication were the environmental impacts categories analyzed. Results indicate that the proposed improvements (especially no-til farming-scenarios s2 and s4) would lead to environmental benefits in prospective scenarios compared to the current ethanol production (scenario s0). Combined first and second generation ethanol production (scenarios s3 and s4) would require less agricultural land but would not perform better than the projected first generation ethanol, although the uncertainties are relatively high. The best use of 1 ha of sugar cane was also assessed, considering the displacement of the conventional products by ethanol and electricity. No-til practices combined with the production of first generation ethanol and electricity (scenario s2) would lead to the largest mitigation effects for global warming and abiotic depletion. For the remaining categories, emissions would not be mitigated with the utilization of the sugar cane products. However, this conclusion is sensitive to the displaced electricity sources.

Genetic Diversity Of Giardia Duodenalis: Multilocus Genotyping Reveals Zoonotic Potential Between Clinical And Environmental Sources In A Metropolitan Region Of Brazil.

Giardia duodenalis is a flagellate protozoan that parasitizes humans and several other mammals. Protozoan contamination has been regularly documented at important environmental sites, although most of these studies were performed at the species level. There is a lack of studies that correlate environmental contamination and clinical infections in the same region. The aim of this study is to evaluate the genetic diversity of a set of clinical and environmental samples and to use the obtained data to characterize the genetic profile of the distribution of G. duodenalis and the potential for zoonotic transmission in a metropolitan region of Brazil. The genetic assemblages and subtypes of G. duodenalis isolates obtained from hospitals, a veterinary clinic, a day-care center and important environmental sites were determined via multilocus sequence-based genotyping using three unlinked gene loci. Cysts of Giardia were detected at all of the environmental sites. Mixed assemblages were detected in 25% of the total samples, and an elevated number of haplotypes was identified. The main haplotypes were shared among the groups, and new subtypes were identified at all loci. Ten multilocus genotypes were identified: 7 for assemblage A and 3 for assemblage B. There is persistent G. duodenalis contamination at important environmental sites in the city. The identified mixed assemblages likely represent mixed infections, suggesting high endemicity of Giardia in these hosts. Most Giardia isolates obtained in this study displayed zoonotic potential. The high degree of genetic diversity in the isolates obtained from both clinical and environmental samples suggests that multiple sources of infection are likely responsible for the detected contamination events. The finding that many multilocus genotypes (MLGs) and haplotypes are shared by different groups suggests that these sources of infection may be related and indicates that there is a notable risk of human infection caused by Giardia in this region.

Reference Values For High-density Lipoprotein Particle Size And Volume By Dynamic Light Scattering In A Brazilian Population Sample And Their Relationships With Metabolic Parameters.

Current data indicate that the size of high-density lipoprotein (HDL) may be considered an important marker for cardiovascular disease risk. We established reference values of mean HDL size and volume in an asymptomatic representative Brazilian population sample (n=590) and their associations with metabolic parameters by gender. Size and volume were determined in HDL isolated from plasma by polyethyleneglycol precipitation of apoB-containing lipoproteins and measured using the dynamic light scattering (DLS) technique. Although the gender and age distributions agreed with other studies, the mean HDL size reference value was slightly lower than in some other populations. Both HDL size and volume were influenced by gender and varied according to age. HDL size was associated with age and HDL-C (total population); non- white ethnicity and CETP inversely (females); HDL-C and PLTP mass (males). On the other hand, HDL volume was determined only by HDL-C (total population and in both genders) and by PLTP mass (males). The reference values for mean HDL size and volume using the DLS technique were established in an asymptomatic and representative Brazilian population sample, as well as their related metabolic factors. HDL-C was a major determinant of HDL size and volume, which were differently modulated in females and in males.

Human Mitochondrial Hsp70 (mortalin): Shedding Light On Atpase Activity, Interaction With Adenosine Nucleotides, Solution Structure And Domain Organization.

The human mitochondrial Hsp70, also called mortalin, is of considerable importance for mitochondria biogenesis and the correct functioning of the cell machinery. In the mitochondrial matrix, mortalin acts in the importing and folding process of nucleus-encoded proteins. The in vivo deregulation of mortalin expression and/or function has been correlated with age-related diseases and certain cancers due to its interaction with the p53 protein. In spite of its critical biological roles, structural and functional studies on mortalin are limited by its insoluble recombinant production. This study provides the first report of the production of folded and soluble recombinant mortalin when co-expressed with the human Hsp70-escort protein 1, but it is still likely prone to self-association. The monomeric fraction of mortalin presented a slightly elongated shape and basal ATPase activity that is higher than that of its cytoplasmic counterpart Hsp70-1A, suggesting that it was obtained in the functional state. Through small angle X-ray scattering, we assessed the low-resolution structural model of monomeric mortalin that is characterized by an elongated shape. This model adequately accommodated high resolution structures of Hsp70 domains indicating its quality. We also observed that mortalin interacts with adenosine nucleotides with high affinity. Thermally induced unfolding experiments indicated that mortalin is formed by at least two domains and that the transition is sensitive to the presence of adenosine nucleotides and that this process is dependent on the presence of Mg2+ ions. Interestingly, the thermal-induced unfolding assays of mortalin suggested the presence of an aggregation/association event, which was not observed for human Hsp70-1A, and this finding may explain its natural tendency for in vivo aggregation. Our study may contribute to the structural understanding of mortalin as well as to contribute for its recombinant production for antitumor compound screenings.

Environmental Controls In The Water Use Patterns Of A Tropical Cloud Forest Tree Species, Drimys Brasiliensis (winteraceae).

Trees from tropical montane cloud forest (TMCF) display very dynamic patterns of water use. They are capable of downwards water transport towards the soil during leaf-wetting events, likely a consequence of foliar water uptake (FWU), as well as high rates of night-time transpiration (Enight) during drier nights. These two processes might represent important sources of water losses and gains to the plant, but little is known about the environmental factors controlling these water fluxes. We evaluated how contrasting atmospheric and soil water conditions control diurnal, nocturnal and seasonal dynamics of sap flow in Drimys brasiliensis (Miers), a common Neotropical cloud forest species. We monitored the seasonal variation of soil water content, micrometeorological conditions and sap flow of D. brasiliensis trees in the field during wet and dry seasons. We also conducted a greenhouse experiment exposing D. brasiliensis saplings under contrasting soil water conditions to deuterium-labelled fog water. We found that during the night D. brasiliensis possesses heightened stomatal sensitivity to soil drought and vapour pressure deficit, which reduces night-time water loss. Leaf-wetting events had a strong suppressive effect on tree transpiration (E). Foliar water uptake increased in magnitude with drier soil and during longer leaf-wetting events. The difference between diurnal and nocturnal stomatal behaviour in D. brasiliensis could be attributed to an optimization of carbon gain when leaves are dry, as well as minimization of nocturnal water loss. The leaf-wetting events on the other hand seem important to D. brasiliensis water balance, especially during soil droughts, both by suppressing tree transpiration (E) and as a small additional water supply through FWU. Our results suggest that decreases in leaf-wetting events in TMCF might increase D. brasiliensis water loss and decrease its water gains, which could compromise its ecophysiological performance and survival during dry periods.

Influence Of Successive Light-activation On Degree Of Conversion And Knoop Hardness Of The First Layered Composite Increment.

To evaluate the influence of light-activation of second, third and fourth increments on degree of conversion (DC) and microhardness (KHN) of the top (T) and bottom (B) surface of the first increment. Forty samples (n = 5) were prepared. In groups 1-4, after each increment light-activation (multiple irradiation), T and B of the first increment were measured in DC and KHN. In groups 5-8, only the first increment was made (single irradiation) and measurements of DC and KHN were taken at 15 min intervals. The light-activation modes were (XL) 500 mW/cm(2) × 38 s (G1/G5); (S) 1000 mW/cm(2) × 19 s (G2/G6), (HP) 1400 mW/cm(2) × 14 s (G3/G7); (PE) 3200 mW/cm(2) × 6 s (G4/G8). Data for DC and KHN were analyzed separately by using PROC MIXED for repeated measures and Tukey-Kramer test (α = 0.05). For KHN, B showed lower values than T. PE resulted in lower values of KHN in B surface. For single and multiple irradiations, T and B of first measurement showed the lowest KHN and the fourth measurement showed the highest, with significant difference between them. For single irradiation, first and second increments presented similar KHN, different from the third and fourth increment, which did not differ between them. For multiple irradiations, the second light-activation resulted in KHN similar to first, third and fourth increments. For DC, except QTH, T presented higher DC than B. The light-activation of successive increments was not able to influence the KHN and DC of the first increment.

Estimativa de bem-estar de frango de corte em função da concentração de amônia e grau de luminosidade no galpão de produção

Brazil is an important poultry meat export country, and large parts of its destination are countries with specific rearing restrictions related to broiler s welfare. One of the aerial pollutants mostly found in high concentrations in closed poultry housing environment is ammonia. There are evidences that broilers welfare may be compromised by the continuous exposition to this pollutant in rearing housing. This research aimed to estimate broilers welfare reared under specific thermal environmental attributes and bird s density, as function of the ammonia concentration and light intensity inside the housing environment using the Fuzzy Theory. Results showed that the best welfare value (0.89 in the scale: 0-1) approximately 90% of the ideal was found in the conditions that associated the ideal thermal environment, with bird s density between 13-15 birds m-2, with values of the ammonia concentration in the environment below 5 ppm, and light intensity near 1 lx. Using the predictive method it was possible to estimate broilers welfare with relation to the ammonia concentration and light intensity in the housing.

Qualidade pós-colheita de caqui 'fuyu' com utilização de diferentes concentrações de cobertura comestível

One of the main objectives of applying edible coatings on fruits surface is to create a protective film to reduce weight loss due to evaporation and transpiration and also to decrease the risk of fruit rot caused by environmental contamination, in order to improve the visual aspect. Therefore, it is possible to increase shelf life, and decrease post harvest losses. Persimmon is a much appreciated fruit, with high potential for export, but sensitive to handling and storage. This study aimed to evaluate the effect of applying the edible coating Megh Wax ECF-124 (18% of active composts, consisting of emulsion of carnauba wax, anionic surfactant, preservative and water) produced by Megh Industry and Commerce Ltda in three different concentrations (25, 50 and 100%) on post harvest quality of 'Fuyu' persimmon stored for 14 days. The attributes evaluated for quality were: firmness, pH, acidity, soluble solids, weight loss and color. The results showed that application of carnauba wax in different concentrations was effective on decreasing weight loss of persimmon cv. Fuyu and maintenance of color aspects. Treatment at lower concentration, 25%, showed lower rate of discharge, but high concentrations showed lower values of mass loss. Carnauba wax application showed a high potential for use on postharvest conservation, and can be applied together with other technologies, helping to maintain quality for export.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Desenvolvimento de uma metodologia para reconstrução da superficie do pe humano por videogrametria

Universidade Estadual de Campinas . Faculdade de Educação Física