9 resultados para Environmental doses

em Repositório da Produção Científica e Intelectual da Unicamp


Relevância:

20.00% 20.00%

Publicador:

Resumo:

This work assessed the environmental impacts of the production and use of 1 MJ of hydrous ethanol (E100) in Brazil in prospective scenarios (2020-2030), considering the deployment of technologies currently under development and better agricultural practices. The life cycle assessment technique was employed using the CML method for the life cycle impact assessment and the Monte Carlo method for the uncertainty analysis. Abiotic depletion, global warming, human toxicity, ecotoxicity, photochemical oxidation, acidification, and eutrophication were the environmental impacts categories analyzed. Results indicate that the proposed improvements (especially no-til farming-scenarios s2 and s4) would lead to environmental benefits in prospective scenarios compared to the current ethanol production (scenario s0). Combined first and second generation ethanol production (scenarios s3 and s4) would require less agricultural land but would not perform better than the projected first generation ethanol, although the uncertainties are relatively high. The best use of 1 ha of sugar cane was also assessed, considering the displacement of the conventional products by ethanol and electricity. No-til practices combined with the production of first generation ethanol and electricity (scenario s2) would lead to the largest mitigation effects for global warming and abiotic depletion. For the remaining categories, emissions would not be mitigated with the utilization of the sugar cane products. However, this conclusion is sensitive to the displaced electricity sources.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Giardia duodenalis is a flagellate protozoan that parasitizes humans and several other mammals. Protozoan contamination has been regularly documented at important environmental sites, although most of these studies were performed at the species level. There is a lack of studies that correlate environmental contamination and clinical infections in the same region. The aim of this study is to evaluate the genetic diversity of a set of clinical and environmental samples and to use the obtained data to characterize the genetic profile of the distribution of G. duodenalis and the potential for zoonotic transmission in a metropolitan region of Brazil. The genetic assemblages and subtypes of G. duodenalis isolates obtained from hospitals, a veterinary clinic, a day-care center and important environmental sites were determined via multilocus sequence-based genotyping using three unlinked gene loci. Cysts of Giardia were detected at all of the environmental sites. Mixed assemblages were detected in 25% of the total samples, and an elevated number of haplotypes was identified. The main haplotypes were shared among the groups, and new subtypes were identified at all loci. Ten multilocus genotypes were identified: 7 for assemblage A and 3 for assemblage B. There is persistent G. duodenalis contamination at important environmental sites in the city. The identified mixed assemblages likely represent mixed infections, suggesting high endemicity of Giardia in these hosts. Most Giardia isolates obtained in this study displayed zoonotic potential. The high degree of genetic diversity in the isolates obtained from both clinical and environmental samples suggests that multiple sources of infection are likely responsible for the detected contamination events. The finding that many multilocus genotypes (MLGs) and haplotypes are shared by different groups suggests that these sources of infection may be related and indicates that there is a notable risk of human infection caused by Giardia in this region.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Trees from tropical montane cloud forest (TMCF) display very dynamic patterns of water use. They are capable of downwards water transport towards the soil during leaf-wetting events, likely a consequence of foliar water uptake (FWU), as well as high rates of night-time transpiration (Enight) during drier nights. These two processes might represent important sources of water losses and gains to the plant, but little is known about the environmental factors controlling these water fluxes. We evaluated how contrasting atmospheric and soil water conditions control diurnal, nocturnal and seasonal dynamics of sap flow in Drimys brasiliensis (Miers), a common Neotropical cloud forest species. We monitored the seasonal variation of soil water content, micrometeorological conditions and sap flow of D. brasiliensis trees in the field during wet and dry seasons. We also conducted a greenhouse experiment exposing D. brasiliensis saplings under contrasting soil water conditions to deuterium-labelled fog water. We found that during the night D. brasiliensis possesses heightened stomatal sensitivity to soil drought and vapour pressure deficit, which reduces night-time water loss. Leaf-wetting events had a strong suppressive effect on tree transpiration (E). Foliar water uptake increased in magnitude with drier soil and during longer leaf-wetting events. The difference between diurnal and nocturnal stomatal behaviour in D. brasiliensis could be attributed to an optimization of carbon gain when leaves are dry, as well as minimization of nocturnal water loss. The leaf-wetting events on the other hand seem important to D. brasiliensis water balance, especially during soil droughts, both by suppressing tree transpiration (E) and as a small additional water supply through FWU. Our results suggest that decreases in leaf-wetting events in TMCF might increase D. brasiliensis water loss and decrease its water gains, which could compromise its ecophysiological performance and survival during dry periods.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The present study aimed to investigate the effects of the interaction between the abusive use of nandrolone decanoate (ND) and physical activity on the prostate structure of adult and older rats. We evaluated whether the use of ND, associated or not with physical exercise during the post-pubertal stage, interferes with the morphophysiology of the prostate. Fifty-six male Sprague-Dawley rats were divided into eight groups. The animals were treated for eight weeks and divided into sedentary and trained groups, with or without ND use. Four groups were sacrificed 48 h after the end of the eight week experiment (adult groups), and four other groups were sacrificed at 300 days of age (older groups). The prostate was collected and processed for stereological and histopathological analysis and for the expression of AQP1 and VEGF by the Western blotting technique. Both ND and physical activity altered the ventral prostate structure of the rats; the AQP1 and VEGF expression increased in young animals subjected to physical exercise. Thus, it was concluded that the use of ND, associated or not with exercise during the post-pubertal stage, interferes with the morphophysiology of the prostate.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Efforts presented by the scientific community in recent years towards the development of numerous green chemical processes and wastewater treatment technologies are presented and discussed. In the light of these approaches, environmentally friendly technologies, as well as the key role played by the well-known advanced oxidation processes, are discussed, giving special attention to the ones comprising ozone applications. Fundamentals and applied aspects dealing with ozone technology and its application are also presented.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The present work evaluated the effect of low doses of X-irradiation on the repairing process of sutured and nonsutured skin wounds in rats. For that, rats underwent a surgical proceedure, in which a 20 x 5-millimeter rectangular wound approximately 2-millimeter-deep was made in the dorsal region of each animal, and were divided in four groups: nonirradiated nonsutured; irradiated nonsutured ; nonirradiated sutured and irradiated sutured. The animals under irradiation were protected, during exposure, with a 2-millimeter-thick lead apron in such a way that only the incision was irradiated. Each animal was submitted to 18 seconds of exposure, undergoing a total of 7.4 rads. The evaluation of the effects of X-rays on the repairing process was carried out through microscopic observation by means of hematoxylin-eosin staining for morphological evaluation, and silver impregnation under polarized light for the observation of collagen synthesis. The results have shown that X-irradiation has caused delay in the repairing process, but it did not stop its development. The irradiated nonsutured group was considered to show the greater delay when compared with the other groups.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

OBJECTIVE: Evaluate the efficacy of cumulative doses (CDs) of 131I-iodide therapy (RIT) in differentiated thyroid cancer (DTC). SUBJECTS AND METHODS: The probability of progressive disease according to CDs was evaluated in patients < 45 years old and > 45 years old and correlated to tumor-node-metastasis (TNM), thyroglobulin values, histological types and variants, age, and zduration of the disease. RESULTS: At the end of a follow-up period of 69 ± 56 months, 85 out of 150 DTC patients submitted to fixed doses RIT had no evidence of disease, 47 had stable disease and 18 had progressive disease. Higher CDs were used in the more aggressive variants (p < 0.0001), higher TNM stages (p < 0.0001), and follicular carcinomas (p = 0.0034). Probability of disease progression was higher with CDs > 600 mCi in patients > 45 years old and with CDs > 800 mCi in patients < 45 years. CONCLUSION: Although some patients may still respond to high CDs, the impact of further RIT should be carefully evaluated and other treatment strategies may be warranted.