5 resultados para Entomopathogenic bacterium

em Repositório da Produção Científica e Intelectual da Unicamp


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Silver nanoparticles have attracted considerable attention due to their beneficial properties. But toxicity issues associated with them are also rising. The reports in the past suggested health hazards of silver nanoparticles at the cellular, molecular, or whole organismal level in eukaryotes. Whereas, there is also need to examine the exposure effects of silver nanoparticle to the microbes, which are beneficial to humans as well as environment. The available literature suggests the harmful effects of physically and chemically synthesised silver nanoparticles. The toxicity of biogenically synthesized nanoparticles has been less studied than physically and chemically synthesised nanoparticles. Hence, there is a greater need to study the toxic effects of biologically synthesised silver nanoparticles in general and mycosynthesized nanoparticles in particular. In the present study, attempts have been made to assess the risk associated with the exposure of mycosynthesized silver nanoparticles on a beneficial soil microbe Pseudomonas putida. KT2440. The study demonstrates mycosynthesis of silver nanoparticles and their characterisation by UV-vis spectrophotometry, FTIR, X-ray diffraction, nanosight LM20 - a particle size distribution analyzer and TEM. Silver nanoparticles obtained herein were found to exert the hazardous effect at the concentration of 0.4μg/ml, which warrants further detailed investigations concerning toxicity.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Xanthomonas citri subsp. citri (X. citri) is the causative agent of the citrus canker, a disease that affects several citrus plants in Brazil and across the world. Although many studies have demonstrated the importance of genes for infection and pathogenesis in this bacterium, there are no data related to phosphate uptake and assimilation pathways. To identify the proteins that are involved in the phosphate response, we performed a proteomic analysis of X. citri extracts after growth in three culture media with different phosphate concentrations. Using mass spectrometry and bioinformatics analysis, we showed that X. citri conserved orthologous genes from Pho regulon in Escherichia coli, including the two-component system PhoR/PhoB, ATP binding cassette (ABC transporter) Pst for phosphate uptake, and the alkaline phosphatase PhoA. Analysis performed under phosphate starvation provided evidence of the relevance of the Pst system for phosphate uptake, as well as both periplasmic binding proteins, PhoX and PstS, which were formed in high abundance. The results from this study are the first evidence of the Pho regulon activation in X. citri and bring new insights for studies related to the bacterial metabolism and physiology. Biological significance Using proteomics and bioinformatics analysis we showed for the first time that the phytopathogenic bacterium X. citri conserves a set of proteins that belong to the Pho regulon, which are induced during phosphate starvation. The most relevant in terms of conservation and up-regulation were the periplasmic-binding proteins PstS and PhoX from the ABC transporter PstSBAC for phosphate, the two-component system composed by PhoR/PhoB and the alkaline phosphatase PhoA.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The taxonomic position of a bacterium isolated from water samples from the Rio Negro, in Amazon, Brazil, was determined by using a polyphasic approach. The organism formed a distinct phyletic line in the Chromobacterium 16S rRNA gene tree and had chemotaxonomic and morphological properties consistent with its classification in this genus. It was found to be closely related to Chromobacterium vaccinii DSM 25150(T) (98.6 % 16S rRNA gene similarity) and shared 98.5 % 16S rRNA gene similarity with Chromobacterium piscinae LGM 3947(T). DNA-DNA relatedness studies showed that isolate CBMAI 310(T) belongs to distinct genomic species. The isolate was readily distinguished from the type strain of these species using a combination of phenotypic and chemotaxonomic properties. Thus, based on genotypic and phenotypic data, it is proposed that isolate CBMAI 310(T) (=DSM 26508(T)) be classified in the genus Chromobacterium as the type strain of a novel species, namely, Chromobacterium amazonense sp. nov.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

In this work, all publicly-accessible published findings on Alicyclobacillus acidoterrestris heat resistance in fruit beverages as affected by temperature and pH were compiled. Then, study characteristics (protocols, fruit and variety, °Brix, pH, temperature, heating medium, culture medium, inactivation method, strains, etc.) were extracted from the primary studies, and some of them incorporated to a meta-analysis mixed-effects linear model based on the basic Bigelow equation describing the heat resistance parameters of this bacterium. The model estimated mean D* values (time needed for one log reduction at a temperature of 95 °C and a pH of 3.5) of Alicyclobacillus in beverages of different fruits, two different concentration types, with and without bacteriocins, and with and without clarification. The zT (temperature change needed to cause one log reduction in D-values) estimated by the meta-analysis model were compared to those ('observed' zT values) reported in the primary studies, and in all cases they were within the confidence intervals of the model. The model was capable of predicting the heat resistance parameters of Alicyclobacillus in fruit beverages beyond the types available in the meta-analytical data. It is expected that the compilation of the thermal resistance of Alicyclobacillus in fruit beverages, carried out in this study, will be of utility to food quality managers in the determination or validation of the lethality of their current heat treatment processes.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.