Beam-energy Dependence Of The Directed Flow Of Protons, Antiprotons, And Pions In Au+au Collisions.

Rapidity-odd directed flow (v1) measurements for charged pions, protons, and antiprotons near midrapidity (y=0) are reported in sNN=7.7, 11.5, 19.6, 27, 39, 62.4, and 200 GeV Au+Au collisions as recorded by the STAR detector at the Relativistic Heavy Ion Collider. At intermediate impact parameters, the proton and net-proton slope parameter dv1/dy|y=0 shows a minimum between 11.5 and 19.6 GeV. In addition, the net-proton dv1/dy|y=0 changes sign twice between 7.7 and 39 GeV. The proton and net-proton results qualitatively resemble predictions of a hydrodynamic model with a first-order phase transition from hadronic matter to deconfined matter, and differ from hadronic transport calculations.

Hypothalamic Inflammation And The Central Nervous System Control Of Energy Homeostasis.

The control of energy homeostasis relies on robust neuronal circuits that regulate food intake and energy expenditure. Although the physiology of these circuits is well understood, the molecular and cellular response of this program to chronic diseases is still largely unclear. Hypothalamic inflammation has emerged as a major driver of energy homeostasis dysfunction in both obesity and anorexia. Importantly, this inflammation disrupts the action of metabolic signals promoting anabolism or supporting catabolism. In this review, we address the evidence that favors hypothalamic inflammation as a factor that resets energy homeostasis in pathological states.

Beam-energy Dependence Of Charge Separation Along The Magnetic Field In Au+au Collisions At Rhic.

Local parity-odd domains are theorized to form inside a quark-gluon plasma which has been produced in high-energy heavy-ion collisions. The local parity-odd domains manifest themselves as charge separation along the magnetic field axis via the chiral magnetic effect. The experimental observation of charge separation has previously been reported for heavy-ion collisions at the top RHIC energies. In this Letter, we present the results of the beam-energy dependence of the charge correlations in Au+Au collisions at midrapidity for center-of-mass energies of 7.7, 11.5, 19.6, 27, 39, and 62.4 GeV from the STAR experiment. After background subtraction, the signal gradually reduces with decreased beam energy and tends to vanish by 7.7 GeV. This implies the dominance of hadronic interactions over partonic ones at lower collision energies.

Rapidly Switching Multidirectional Defibrillation: Reversal Of Ventricular Fibrillation With Lower Energy Shocks.

Cardiac arrest after open surgery has an incidence of approximately 3%, of which more than 50% of the cases are due to ventricular fibrillation. Electrical defibrillation is the most effective therapy for terminating cardiac arrhythmias associated with unstable hemodynamics. The excitation threshold of myocardial microstructures is lower when external electrical fields are applied in the longitudinal direction with respect to the major axis of cells. However, in the heart, cell bundles are disposed in several directions. Improved myocardial excitation and defibrillation have been achieved by applying shocks in multiple directions via intracardiac leads, but the results are controversial when the electrodes are not located within the cardiac chambers. This study was designed to test whether rapidly switching shock delivery in 3 directions could increase the efficiency of direct defibrillation. A multidirectional defibrillator and paddles bearing 3 electrodes each were developed and used in vivo for the reversal of electrically induced ventricular fibrillation in an anesthetized open-chest swine model. Direct defibrillation was performed by unidirectional and multidirectional shocks applied in an alternating fashion. Survival analysis was used to estimate the relationship between the probability of defibrillation and the shock energy. Compared with shock delivery in a single direction in the same animal population, the shock energy required for multidirectional defibrillation was 20% to 30% lower (P < .05) within a wide range of success probabilities. Rapidly switching multidirectional shock delivery required lower shock energy for ventricular fibrillation termination and may be a safer alternative for restoring cardiac sinus rhythm.

Beam Energy Dependence Of Moments Of The Net-charge Multiplicity Distributions In Au+au Collisions At Rhic.

We report the first measurements of the moments--mean (M), variance (σ(2)), skewness (S), and kurtosis (κ)--of the net-charge multiplicity distributions at midrapidity in Au+Au collisions at seven energies, ranging from sqrt[sNN]=7.7 to 200 GeV, as a part of the Beam Energy Scan program at RHIC. The moments are related to the thermodynamic susceptibilities of net charge, and are sensitive to the location of the QCD critical point. We compare the products of the moments, σ(2)/M, Sσ, and κσ(2), with the expectations from Poisson and negative binomial distributions (NBDs). The Sσ values deviate from the Poisson baseline and are close to the NBD baseline, while the κσ(2) values tend to lie between the two. Within the present uncertainties, our data do not show nonmonotonic behavior as a function of collision energy. These measurements provide a valuable tool to extract the freeze-out parameters in heavy-ion collisions by comparing with theoretical models.

Hypothalamic S1p/s1pr1 Axis Controls Energy Homeostasis.

Sphingosine 1-phosphate receptor 1 (S1PR1) is a G-protein-coupled receptor for sphingosine-1-phosphate (S1P) that has a role in many physiological and pathophysiological processes. Here we show that the S1P/S1PR1 signalling pathway in hypothalamic neurons regulates energy homeostasis in rodents. We demonstrate that S1PR1 protein is highly enriched in hypothalamic POMC neurons of rats. Intracerebroventricular injections of the bioactive lipid, S1P, reduce food consumption and increase rat energy expenditure through persistent activation of STAT3 and the melanocortin system. Similarly, the selective disruption of hypothalamic S1PR1 increases food intake and reduces the respiratory exchange ratio. We further show that STAT3 controls S1PR1 expression in neurons via a positive feedback mechanism. Interestingly, several models of obesity and cancer anorexia display an imbalance of hypothalamic S1P/S1PR1/STAT3 axis, whereas pharmacological intervention ameliorates these phenotypes. Taken together, our data demonstrate that the neuronal S1P/S1PR1/STAT3 signalling axis plays a critical role in the control of energy homeostasis in rats.

The Lea Grating Test In Assessing Detection Grating Acuity In Normal Infants Less Than 4 Months Of Age.

To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.

Determination Of Tetrakis(hydroxymethyl)phosphonium Sulfate In Commercial Formulations And Cooling Water By Capillary Electrophoresis With Contactless Conductivity Detection.

A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.

Human Herpesvirus Infections Of The Central Nervous System: Laboratory Diagnosis Based On Dna Detection By Nested Pcr In Plasma And Cerebrospinal Fluid Samples.

Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.

Detection Of Explosives On The Surface Of Banknotes By Raman Hyperspectral Imaging And Independent Component Analysis.

The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).

A screening method for detection of hexavalent chromium levels in soils

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.