14 resultados para Ecologia de peixos

em Repositório da Produção Científica e Intelectual da Unicamp


Relevância:

10.00% 10.00%

Publicador:

Resumo:

In insects that utilize patchy and ephemeral resources for feeding and egg laying, the outcome of larval competition for food resources depends on the amount of resources and the spatial distribution of immatures among patches of food. In the present study, the results of larval competition for food in Chrysomya megacephala, in traits such as female weight, fecundity and reproductive investment, were different in situations where the level of larval aggregation (proportion of competitors per amount of food) was the same, but with densities of competitors and amounts of food proportionally different. These results are indicative that the larval competition may depend both on the larval density and the amount of food, in different situations with the same proportion of larvae per gram of food.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The Orchidaceae is one of the largest flowering plants family and with a great importance to conservation. However, no survey on orchid flowers can be found in Mato Grosso do Sul. Thus, the objective of this work was to make a survey of the Orchidaceae species and of its ecology features in a riparian forest in a fragment of Floresta Estacional Semi-Decidual that belongs to the riparian forest of the Dourados River. The inventory was made by using a sweeping method for collection, and in addition to this the vertical and horizontal position of epiphytes were assessed on the hosts. For characterization of microclimate, it was used a thermohygrometer and luximeter. It was identified 17 species of 13 genera. Of the listed genera, the most abundant ones were: Acianthera, Macradenia and Capanemia. It was also noted a vertical and horizontal distribution of the Orchidaceae in relation to inverse gradient of water and light availability. Some species tended to be sensitive to height level categorization, whereas others seemed to occur with similar frequency along the host. In relation to the cardinal orientation, the apparent preferential response for south and east directions was associated to the low sampling effort and lower water availability, which could occur because the north face is opposed to the water body.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The variation in the proportion of reproductive branches, fruit, and seed production of Ipomoea pes-caprae (L.) R. Br. (Convolvulaceae) were evaluated at ten beaches on Santa Catarina Island, state of Santa Catarina, Brazil. Three patches per beach of Ipomoea pes-caprae were monitored, involving two reproductive cycles. Ipomoea pes-caprae presented initially an average length of patches of 14 m, with 9.6 branches/m² and 39% of reproductive branches. The proportion of reproductive branches varied between the cycles, but there was not noticed an alternation of reproductive effort between the subsequent cycles. There was a reduction in the percentage of reproductive branches at six localities. In four beaches where Ipomoea pes-caprae populations declined, occurred reduction in the reproductive vigor, and in the seed production, being these declines associated to strong sea erosion. In another hand, in one beach with population increase, there were little reproductive branches due to the occurrence of young stolons. Four patches never maturated fruits, being three of these located at small beaches. The fruit and seed productions in the patches showed values up to 40 fruits/m² and up to 140 seeds/m², respectively. Populations with great seed production were localized in areas adjacent to great coastal plains, which may represent potential seed sources for areas with small seed production in the island.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The main purpose of this work was to study the germination of Ternstroemia brasiliensis seeds both in laboratory and field conditions in order to contribute to understanding the regeneration ecology of the species. The seeds were dispersed with relatively high moisture content and exhibit a recalcitrant storage behaviour because of their sensitivity to dehydration and to dry storage. The germinability is relatively high and is not affected either by light or aril presence. The absence of the dormancy and the low sensitivity to far red light can enable to seeds to promptly germinate under Restinga forest canopy, not forming a soil seed bank. The constant temperatures of 25 ºC and 30 ºC were considered optimum for germination of T. brasiliensis seeds. Temperature germination parameters can be affected by light conditions. The thermal-time model can be a suitable tool for investigating the temperature dependence on the seed germination of T. brasiliensis. The germination characteristics de T. brasiliensis are typical of non pioneer species, and help to explain the distribution of the species. Germination of T. brasiliensis seeds in Restinga environment may be not limited by light and temperature; otherwise the soil moisture content can affect the seed germination.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Prey size is an important factor in food consumption. In studies of feeding ecology, prey items are usually measured individually using calipers or ocular micrometers. Among amphibians and reptiles, there are species that feed on large numbers of small prey items (e.g. ants, termites). This high intake makes it difficult to estimate prey size consumed by these animals. We addressed this problem by developing and evaluating a procedure for subsampling the stomach contents of such predators in order to estimate prey size. Specifically, we developed a protocol based on a bootstrap procedure to obtain a subsample with a precision error of at the most 5%, with a confidence level of at least 95%. This guideline should reduce the sampling effort and facilitate future studies on the feeding habits of amphibians and reptiles, and also provide a means of obtaining precise estimates of prey size.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The behaviour of the albino and melanic variants of Biomphalaria glabrata of Belo Horizonte (MG. Brazil) was studied comparatively, in terms of their respective susceptibilities to infection by Schistosoma mansoni of the same origin, through observation of the elimination of cercariae for a three-month period and the calculation of mortality and infection rates, in control and in infected snails. The number of amoebocytes, granulocytes and hyalinocytes in the circulating hemolymph during different periods of infection was analyzed. The evolution of the infection in the tissues was observed by means of histological cross-sections. The melanic variant showed greater susceptibility to infection and a higher mortality rate. The albino variant showed a higher number of circulating amoebocytes, both granulocytes and hyalinocytes. A higher number of degenerated sporocysts were seen in the histological cross-sections of the albino variant. The results suggest that the melanic variant of B. glabrata was more susceptible to infection by S. mansoni than was the albino variant.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

This work investigated the cytotoxic and genotoxic potential of water from the River Paraíba do Sul (Brazil) using Allium cepa roots. An anatomo-morphological parameter (root length), mitotic indices, and frequency of micronuclei were analysed. Eight bulbs were chosen at random for treatment for 24 to 120 hours with the River water collected in the years of 2005 and 2006 from sites in the cities of Tremembé and Aparecida (São Paulo state, Brazil). Daily measurements of the length of the roots grown from each bulb were carried out throughout the experiment. Mitotic index (MI) and frequency of micronuclei (MN) were determined for 2000 cells per root, using 3-5 root tips from other bulbs (7-10). Only in the roots treated with samples of the River water collected in 2005 in Tremembé city was there a decrease in the root length growth compared to the respective control. However, a reduction in MI values was verified for both sites analysed for that year. Considering the data involving root length growth and especially MI values, a cytotoxic potential is suggested for the water of the River Paraíba do Sul at Tremembé and Aparecida, in the year of 2005. On the other hand, since in this year the MN frequency was not affected with the river water treatments, genotoxicity is not assumed for the river water sampled at the aforementioned places.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Food habits of jaguarundi (Puma yagouaroundi) (Geoffroy, 1803) (Carnivora, Felidae) were studied between November 2000 and November 2001, in a 24.9 km² area of secondary Atlantic Rainforest and eucalypt plantation, in the Serra de Paranapiacaba, São Paulo State, Brazil. Analyses of 26 fecal and regurgitate samples, obtained over a stretch of 570.1 km, showed the consumption of 19 prey items and 74 prey occurrences. Small mammals were the most frequent food item (42.5%), followed by birds (21%), reptiles (14%) and medium-sized mammals (3%). The percent occurrence (PO) suggests that the diet consisted mainly of small rodents (30%) and birds (21%). We recorded for the first time the predation of Viperidae snakes by P. yagouaroundi. Although having a large list of items and range of dietary niche breadths (Bsta = 0.76), our data show that jaguarundi prey mainly on small vertebrates (mammals, birds or reptiles), and even in tall tropical forests or eucalypt plantations, it preys mostly on animals that come to, or live on, the ground.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

A new species of dactylogyrid monogenean, Apedunculata discoidea gen. n., sp. n. is described and illustrated from the gills of the freshwater fish Prochilodus lineatus (Valenciennes, 1837) in pisciculture ponds from Pirassununga, São Paulo, Brazil. Diagnostic characters of the new genus and species are: 1) vagina dextrolateral slightly sclerotised, opening anteriorly at level of copulatory complex; 2) copulatory organ coiled with two counterclockwise rings; 3) Accessory piece distal and not articulated; 4) body disk-shaped, lacking a peduncle.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física