7 resultados para Early Detection of Cancer

em Repositório da Produção Científica e Intelectual da Unicamp


Relevância:

100.00% 100.00%

Publicador:

Resumo:

Hypothalamic inflammation is a common feature of experimental obesity. Dietary fats are important triggers of this process, inducing the activation of toll-like receptor-4 (TLR4) signaling and endoplasmic reticulum stress. Microglia cells, which are the cellular components of the innate immune system in the brain, are expected to play a role in the early activation of diet-induced hypothalamic inflammation. Here, we use bone marrow transplants to generate mice chimeras that express a functional TLR4 in the entire body except in bone marrow-derived cells or only in bone marrow-derived cells. We show that a functional TLR4 in bone marrow-derived cells is required for the complete expression of the diet-induced obese phenotype and for the perpetuation of inflammation in the hypothalamus. In an obesity-prone mouse strain, the chemokine CX3CL1 (fractalkine) is rapidly induced in the neurons of the hypothalamus after the introduction of a high-fat diet. The inhibition of hypothalamic fractalkine reduces diet-induced hypothalamic inflammation and the recruitment of bone marrow-derived monocytic cells to the hypothalamus; in addition, this inhibition reduces obesity and protects against diet-induced glucose intolerance. Thus, fractalkine is an important player in the early induction of diet-induced hypothalamic inflammation, and its inhibition impairs the induction of the obese and glucose intolerance phenotypes.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The premature fusion of unilateral coronal suture can cause a significant asymmetry of the craniofacial skeleton, with an oblique deviation of the cranial base that negatively impacts soft tissue facial symmetry. The purpose of this study was to assess facial symmetry obtained in patients with unilateral coronal synostosis (UCS) surgically treated by 2 different techniques. We hypothesized that nasal deviation should not be addressed in a primary surgical correction of UCS. Consecutive UCS patients were enrolled in a prospective study and randomly divided into 2 groups. In group 1, the patients underwent total frontal reconstruction and transferring of onlay bone grafts to the recessive superior orbital rim (n = 7), and in group 2, the patients underwent total frontal reconstruction and unilateral fronto-orbital advancement (n = 5). Computerized photogrammetric analysis measured vertical and horizontal axis of the nose and the orbital globe in the preoperative and postoperative periods. Intragroup and intergroup comparisons were performed. Intragroup preoperative and postoperative comparisons showed a significant (all P < 0.05) reduction of the nasal axis and the orbital-globe axis in the postoperative period in the 2 groups. Intergroup comparisons showed no significant difference (all P > 0.05). Facial symmetry was achieved in the patients with UCS who underwent surgery regardless of surgical approach evaluated here. Our data showed a significant improvement in nasal and orbital-globe deviation, leading us to question the necessity of primary nasal correction in these patients.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).

Relevância:

100.00% 100.00%

Publicador:

Resumo:

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

OBJECTIVE: To verify if the frequency of spontaneous pubertal development among girls with Turner syndrome (TS) diagnosed in infancy and childhood is greater than that of patients diagnosed later. SUBJECTS AND METHODS: Thirty three girls aged < 10 years at the time of diagnosis were evaluated regarding pubertal development. The frequency of spontaneous puberty was compared with that of girls aged > 13 years diagnosed at the same service. RESULTS: Sixteen of 32 informative patients had signs of spontaneous puberty, a frequency greater than that of patients diagnosed later. In six patients, there was no progression of puberty; menarche occurred in six, and one became pregnant, but the fetus was a stillborn. Spontaneous puberty was absent in all cases with 45,X karyotype. CONCLUSIONS: The greater prevalence of spontaneous puberty in girls whose diagnosis was not based on pubertal delay suggests that, among those diagnosed later, there is a bias towards patients with hypogonadism. Arq Bras Endocrinol Metab. 2012;56(9):653-7