5 resultados para EXTREME PRECIPITATION EVENTS

em Repositório da Produção Científica e Intelectual da Unicamp


Relevância:

20.00% 20.00%

Publicador:

Resumo:

We report the observation of multiple harmonic generation in electric dipole spin resonance in an InAs nanowire double quantum dot. The harmonics display a remarkable detuning dependence: near the interdot charge transition as many as eight harmonics are observed, while at large detunings we only observe the fundamental spin resonance condition. The detuning dependence indicates that the observed harmonics may be due to Landau-Zener transition dynamics at anticrossings in the energy level spectrum.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

El Niño South Oscillation (ENSO) is one climatic phenomenon related to the inter-annual variability of global meteorological patterns influencing sea surface temperature and rainfall variability. It influences human health indirectly through extreme temperature and moisture conditions that may accelerate the spread of some vector-borne viral diseases, like dengue fever (DF). This work examines the spatial distribution of association between ENSO and DF in the countries of the Americas during 1995-2004, which includes the 1997-1998 El Niño, one of the most important climatic events of 20(th) century. Data regarding the South Oscillation index (SOI), indicating El Niño-La Niña activity, were obtained from Australian Bureau of Meteorology. The annual DF incidence (AIy) by country was computed using Pan-American Health Association data. SOI and AIy values were standardised as deviations from the mean and plotted in bars-line graphics. The regression coefficient values between SOI and AIy (rSOI,AI) were calculated and spatially interpolated by an inverse distance weighted algorithm. The results indicate that among the five years registering high number of cases (1998, 2002, 2001, 2003 and 1997), four had El Niño activity. In the southern hemisphere, the annual spatial weighted mean centre of epidemics moved southward, from 6° 31' S in 1995 to 21° 12' S in 1999 and the rSOI,AI values were negative in Cuba, Belize, Guyana and Costa Rica, indicating a synchrony between higher DF incidence rates and a higher El Niño activity. The rSOI,AI map allows visualisation of a graded surface with higher values of ENSO-DF associations for Mexico, Central America, northern Caribbean islands and the extreme north-northwest of South America.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This study aimed to check for any significant differences in perceived quality of life, specifically aspects of a physical nature, among volunteers who are more physically active and those less physically active in a university community. The sample consisted of 1,966 volunteers in a university community in Brazil. To assess physical activity levels, volunteers responded to the International Physical Activity Questionnaire (IPAQ), and to analyse the perception of quality of life they responded to WHOQOL-bref, which is classified into three groups according to level of physical activity, taking into account the metabolic equivalent index (MET) over a full week. For comparison, consideration was given to the first and third tertiles, respectively, namely groups of more and less active students. The results indicated that individuals who engaged in more physical activity had a more positive perception of quality of life compared to those who were less active in physical aspects related to the ability to work, energy for day-to-day activities and locomotion.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

INTRODUCTION: Data is scarce regarding adverse events (AE) of biological therapy used in the management of Crohn's Disease (CD) among Brazilian patients. OBJECTIVES: To analyse AE prevalence and profile in patients with CD treated with Infliximab (IFX) or Adalimumab (ADA) and to verify whether there are differences between the two drugs. METHOD: Retrospective observational single-centre study of CD patients on biological therapy. Variables analysed: Demographic data, Montreal classification, biological agent administered, treatment duration, presence and type of AE and the need for treatment interruption. RESULTS: Forty-nine patients were analysed, 25 treated with ADA and 24 with IFX. The groups were homogeneous in relation to the variables studied. The average follow-up period for the group treated with ADA was 19.3 months and 21.8 months for the IFX group (p = 0.585). Overall, 40% (n = 10) of patients taking ADA had AE compared with 50% (n = 12) of IFX users (p = 0.571). There was a tendency towards higher incidence of cutaneous and infusion reactions in the IFX group and higher incidence of infections in the ADA treated group, although without significant difference. CONCLUSIONS: No difference was found in the AE prevalence and profile between ADA and IFX CD patients in the population studied.